Thermal cycle dice real time system

Manufactured by Takara Bio

Sourced in Japan

The Thermal Cycle Dice® Real Time System is a compact and versatile PCR (Polymerase Chain Reaction) instrument designed for rapid and accurate nucleic acid amplification and detection. It features a multiple-well format for simultaneous processing of samples, enabling efficient high-throughput analysis.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Thermal Cycle Dice real-time PCR system Thermal Cycle Dice Real Time system TP800 Dice Real Time System Thermal Cycle Dice Real‐Time System

11 protocols using thermal cycle dice real time system

Quantitative analysis of S. japonica GST genes

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total S. japonica RNA extraction and first-strand cDNA synthesis followed Lu (2020) [55 (link)]. cDNA was stored at − 20 °C for subsequent analysis. Gene-specific primers used for qRT-PCR are listed in Table 5. qRT-PCR was performed on a Takara Thermal Cycle Dice™ Real-Time System (Takara, Japan). Conditions used for qRT-PCR were as follows: 94 °C for 2 min 30 s; 40 cycles of 94 °C for 15 s, 55 °C for 30 s, and 72 °C for 25 s; and one cycle of 95 °C for 15 s, 60 °C for 60 s, and 72 °C for 15 s. Three biological replicates were performed. Reaction mixtures, internal control, and relative transcriptional levels calculation method referred the protocols of Lu et al. (2020) [55 (link)]. SPSS 26.0 was used for statistical analysis.

Table 5

Primers used for qRT-PCR

Gene	Forward primer (5′-3′)	Reverse primer (5′-3′)
β-actin	GACGGGTAAGGAAGAACGG	GGGACAACCAAAACAAGGGCAGGAT
SjGST4	CTCGTACTTCCCGTTCCTCG	CCAGCCCTCACGAAGTAGTC
SjGST20	ATAGAGGACATCGCCAGCAAG	CTTCACCTTGGGGTGTTCCAT
SjGST22	GAATTTGGCGCTCTCAAGCC	GTCGTCGGAAGGGTACAGTC

Lu C., Zhang P., Li S., Cheng M, & Duan D. (2023). Isolation and characterization of glutathione S-transferase genes and their transcripts in Saccharina japonica (Laminariales, Phaeophyceae) during development and under abiotic stress. BMC Plant Biology, 23, 436.

+ Open protocol

+ Expand

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from various plant tissues using NucleoZOL Reagent Kit according to the manufacturer’s protocol (MACHEREY-NAGEL GmbH & Co. KG). The genomic DNA removal and the first stand cDNA synthesis were carried out using the ReverTra Ace qPCR RT Master Mix Kit (Toyobo, Japan). Fast Star Essential DNA Green Master Kit (Roche, Switzerland) was chosen for qRT-PCR analysis and performed on a Thermal Cycle Dice® Real Time System (TaKaRa, Japan). An ubiquitin gene (LOC_Os03g13170) was used as an internal control. Primers used for qRT-PCR are listed in Additional file 5: Table S2. Three replicates were used for each biological sample and the means were used for analysis.

Xu X., Chen Z., Shi Y.F., Wang H.M., He Y., Shi L., Chen T., Wu J.L, & Zhang X.B. (2018). Functional inactivation of OsGCNT induces enhanced disease resistance to Xanthomonas oryzae pv. oryzae in rice. BMC Plant Biology, 18, 264.

+ Open protocol

+ Expand

Quantitative VEGF-A and SP1 mRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

After a 12 h incubation with AGEs and/or HQ, ARPE-19 cells were harvested, and total RNA was prepared as described [21] (link), [22] (link), [28] (link). The PCR primers corresponding to nucleotides 1131–1151 and 1186–1206 for human VEGF-A mRNA (NM_001025370), 305–329 and 374–395 for human specificity protein 1 (SP1) mRNA (NM_138473), and 420–437 and 492–509 for human ß-actin mRNA (NM_001101) were synthesized by Nihon Gene Research Laboratories (NGRL) (Sendai, Japan) as described [20] (link), [21] (link), [22] (link), [26] (link), [27] (link), [28] (link), [29] , [30] , [31] (link). Real-time reverse transcription polymerase chain reaction (RT-PCR) was performed using SYBR^® Fast qPCR kit (KAPA Biosystems, Wilmington, MA) and Thermal Cycle Dice^® Real Time System (Takara Bio Inc.) as described [20] (link), [21] (link), [22] (link), [28] (link), [30] . Target cDNAs were cloned into pBluescript SK(-) plasmid (Stratagene, La Jolla, CA) and sequential 10-fold dilutions from 10²–10⁷ copies/µL were prepared. The serial dilutions were run to verify the specificity and to test the sensitivity of the SYBR Green-based real-time RT-PCR. The mRNA expression levels were normalized to the mRNA level of ß-actin, which was used to account for difference in the efficiency of reverse transcription between samples.

Tsujinaka H., Itaya-Hironaka A., Yamauchi A., Sakuramoto-Tsuchida S., Ota H., Takeda M., Fujimura T., Takasawa S, & Ogata N. (2015). Human retinal pigment epithelial cell proliferation by the combined stimulation of hydroquinone and advanced glycation end-products via up-regulation of VEGF gene. Biochemistry and Biophysics Reports, 2, 123-131.

+ Open protocol

+ Expand

Validating RNA-seq with qRT-PCR for Stress Genes

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

qRT-PCR was used to validate qualification of RNA-seq for four genes (ST1, ST2, ST3 and ST4) and detected the transcript levels of the nine target genes with different FPKM values (ST1, ST2, ST11, ST12, ST21, ST31, ST32, ST39 and ST44) under low salinity and drought stresses. Gene-specific primers used for qRT-PCR were designed using Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) (Table 4).
qRT-PCR was performed on a Takara Thermal Cycle Dice™ Real Time System (Takara, Japan). A 10 μL qRT-PCR reaction contained 5 μL 2 × SPARKscript II RT Plus Master Mix (SparkJade Science Co., Ltd., China), 1 μL template, 0.2 μL of each of the forward and reverse primers (10 μM), and 3.6 μL ddH₂O. Conditions used for qRT-PCR were as follows: 95 °C for 2 min 30 s, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s; and one cycle of 95 °C for 15 s, 60 °C for 60 s and 72 °C for 15 s. Three biological repeats and two technical replicates were performed. The relative transcriptional levels of the genes were calculated by the 2^-ΔΔCt method [63 (link)], and β-actin was used as the internal reference [64 (link)].

Lu C., Shao Z., Zhang P, & Duan D. (2020). Genome-wide analysis of the Saccharina japonica sulfotransferase genes and their transcriptional profiles during whole developmental periods and under abiotic stresses. BMC Plant Biology, 20, 271.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using a NucleoZOL Reagent Kit (MACHEREY-NAGEL, Düren, Germany) according to the manufacturer’s instructions. RNA was reverse-transcribed using the ReverTra Ace qPCR RT Master Mix with genomic DNA (gDNA) Remover Kit (Toyobo, Osaka, Japan). Real-time fluorescent quantitative PCR (qRT-PCR) was carried out using the FastStar Essential DNA Green Master Kit (Roche, Basel, Switzerland) and performed on a Thermal Cycle Dice Real Time System (Takara, Kusatsu, Japan). Rice ubiquitin (LOC_Os03g13170) was used as an internal control. The primers used for qRT-PCR are listed in Table S2. The means from three replicates were used for analysis.

He Y., Zhang Z., Li L., Tang S, & Wu J.L. (2018). Genetic and Physio-Biochemical Characterization of a Novel Premature Senescence Leaf Mutant in Rice (Oryza sativa L.). International Journal of Molecular Sciences, 19(8), 2339.

+ Open protocol

+ Expand

Chitinase Gene Expression in T. pseudonana

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

After 48 h of stress treatment, a 1 mL sample was taken from each flask for measurement of chitinase activity using the Solarbio Chitinase Assay Kit (Cat#BC0820) following the manufacturer’s instructions. The remaining 49 mL of T. pseudonana cells in each flask were collected by centrifugation at 2850 g, washed once with fresh medium, and flash-frozen in liquid nitrogen. The T. pseudonana cell pellets were homogenized by vortexing in TRIzol reagent (Invitrogen, Waltham, MA, USA), then centrifuged at 9700 g. The supernatants were used for RNA extraction with chloroform and isopropanol. RNA pellets were resuspended in diethyl pyrocarbonate-treated water, followed by elimination of genomic DNA and synthesis of complementary DNA (cDNA) with a PrimeScript RT reagent kit (Takara, Japan). The synthesized cDNA was then used for qRT–PCR experiments.
The transcriptional profiles of 14 randomly selected T. pseudonana chitinase genes were obtained by qRT–PCR using TB Green™ Premix Ex Taq™ II (Takara, Japan) and a Thermal Cycle Dice™ Real Time System (Takara, Japan). Gene-specific qRT–PCR primers were designed using the NCBI Primer-BLAST website [70 (link)]. Information on primers is provided in Table S9. The beta tubulin gene (TUB3) was used as the reference gene for normalizing the expression of the T. pseudonana chitinase genes [71 (link)].

Cheng H., Shao Z., Lu C, & Duan D. (2021). Genome-wide identification of chitinase genes in Thalassiosira pseudonana and analysis of their expression under abiotic stresses. BMC Plant Biology, 21, 87.

+ Open protocol

+ Expand

Quantifying CXCR4 Expression in Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA of MDA-MB-435s and MDA-MB-231 cells treated with or without TPD7 were isolated using total RNA extracted kit according to the manufacturer’s protocol. The RT-PCR was performed with PrimeScript RT Master Mix Perfect Real Time kit (TaKaRa DRR036A). Real-time PCR was performed with SYBR® Premix Ex TaqTM II and a Thermal Cycle Dice Real time system (TaKaRa). The result was analysed using the manufacturer’s program (Thermal Cycler Dice™ Real Time System). The primer sequences were as following: GAPDH forward primer: 5′-GCACCGTCAAGGCTGAGAAC-3′; GAPDH reverse primer: 5′-TGGTGAAGACGCCAGTGGA-3′; CXCR4 forward primer: 5′-CCTGCCTGGTATTGTCATCCTG-3′; CXCR4 reverse primer: 5′-ACTGTGGTCTTGAGGGCCTTG-3′. Melt curve analysis was performed at the end of each PCR to confirm the specificity of the PCR product. Threshold cycle (Ct) values of CXCR4 in each sample were normalized with the GAPDH expression.

Zhan Y., Zhang H., Li J., Zhang Y., Zhang J, & He L. (2015). A novel biphenyl urea derivate inhibits the invasion of breast cancer through the modulation of CXCR4. Journal of Cellular and Molecular Medicine, 19(7), 1614-1623.

+ Open protocol

+ Expand

Quantifying Gene Expression in Rice Mutants

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA was isolated from flag leaves of WT and the mutants at the heading stage using the NucleoZOL Reagent Kit according to the manufacturer’s instructions (MACHEREY-NAGEL, Düren, Germany). The first strand of copy DNA (cDNA) was synthesized using the ReverTra Ace qPCR RT Master Mix with genomic DNA (gDNA) Remover Kit (Toyobo, Osaka, Japan). Real-time fluorescent quantitative PCR was carried out using the FastStar Essential DNA Green Master Kit (Roche, Basel, Switzerland) and performed on a Thermal Cycle Dice^® Real Time System (Takara, Kusatsu, Japan). All target genes were normalized to the rice internal control gene Ubiquitin (LOC_Os03g13170) to detect the relative expression levels. Three biological repeats were conducted to obtain the final results. The primers for the qRT-PCR are listed in Table S1.

He Y., Li L., Zhang Z, & Wu J.L. (2018). Identification and Comparative Analysis of Premature Senescence Leaf Mutants in Rice (Oryza sativa L.). International Journal of Molecular Sciences, 19(1), 140.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of Gametogenesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs were isolated from whole gonads of wild-type and BAC transgenic mice at each stage by RNeasy Mini Kit (Qiagen). One hundred ng (1W to 5W) and 40 ng (E12.5 to P0) of total RNA were used for cDNA synthesis using Prime Script RT Reagent Kits with gDNA Erase according to the manufacturer’s protocol (Takara). Real time PCR was performed with KAPA SYBR FAST qPCR kits using a thermal cycle dice real time system (Takara). The obtained data was normalized by Mvh.
The following primers were used for PCR amplification:
Dazl
Forward: 5′−CACGCCTCAGTGACTCGGCGAC−3’
Reverse: 5′−CGAAGCATACAGACAGTGGTC−3’
Mvh
Forward: 5′−GTTGAAGTATCTGGACATGATGCAC−3’
Reverse: 5′−CGAGTTGGTGCTACAATAATACACTC−3’
G3pdh
Forward: 5′−ACCACAGTCCATGCCATCAC−3’
Reverse: 5′−TCCACCACCCTGTTGCTGTA−3’
FLAG tagged DazlForward: 5′−CACGCCTCAGTGACTCGGCGAC−3’
Reverse: 5′−CACCGTCATGGTCTTGTAGTC−3’
Dazl cKO
Forward: 5′−GACTTACATGCAGCCTCCAACCATG−3’
Reverse: 5′−AACAGGCAGCTGATATCCAGTGATG−3’

Fukuda K., Masuda A., Naka T., Suzuki A., Kato Y, & Saga Y. (2018). Requirement of the 3′-UTR-dependent suppression of DAZL in oocytes for pre-implantation mouse development. PLoS Genetics, 14(6), e1007436.

+ Open protocol

+ Expand

Quantitative RT-PCR from Total RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNA was synthesized from 500 ng total RNA. Five microliters of cDNA (10 ng/μL) was amplified using the Thermal Cycle Dice Real Time System (TaKaRa). Primers used in this study are listed in Table S1.

Hiruma K., Gerlach N., Sacristán S., Nakano R.T., Hacquard S., Kracher B., Neumann U., Ramírez D., Bucher M., O’Connell R.J, & Schulze-Lefert P. (2016). Root Endophyte Colletotrichum tofieldiae Confers Plant Fitness Benefits that Are Phosphate Status Dependent. Cell, 165(2), 464-474.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!