Siglo risc free sirna

The small interfering RNA (siRNA) for NudC (5’–AACACCTTCTTCAGCTTCCTT– 3’ NM-006600, nucleotides 204–224) (Dharmacon) was described previously [32 (link)–34 (link)]. Firefly (Photonius pyralis) luciferase siRNA was used as a control (Dharmacon). In initial experiments, cells were also co-transfected with siGLO RISC-free siRNA (Dharmacon), a fluorescent non-targeting control oligonucleotide, at a 10:1 siRNA:siGLO ratio, to mark siRNA uptake in transfected cells. HeLa cells (3 x 10⁴ cells) were plated onto poly-L-lysine coated 18-mm coverslips (Fisher Scientific) in a 12-well dish for immunofluorescence, using antibiotic-free OptiMEM (Invitrogen) supplemented with 10% FBS for 24 h. Appropriate siRNA (120 pmol) was diluted in 24 μl pure OptiMEM. In a separate tube, 6 μl Oligofectamine (Invitrogen) was diluted in 100 μl pure OptiMEM, incubated at room temperature for 5 min, added to the diluted siRNA mixture, and allowed to incubate for 20 min at room temperature. The siRNA mixture was then added to the cells and incubated for 72 h to ensure a good knockdown of NudC.

Specific silencing of VRK1 was performed using siVRK1-02 (siV1-02), designed with the SMARTselection algorithm (Dharmacon, Lafayette, CO) and obtained from Dharmacon (DHARMACON RNA Technologies). The sequence target of siVRK1-02 is 5'-CAAGGAACCTGGTGTTGAA-3'. As negative control, the “ON-TARGETplus siCONTROL Non-targeting siRNA” from DHARMACON was used. The efficiency of RNAi transfection was determined with “siGLO RISC-free siRNA” (DHARMACON) labeled with a red fluorochrome [21 (link)].
Cells were transfected with the indicated siRNA at a concentration of 20 nM using Lipofectamine 2000 Reagent” (Invitrogen, Carlsbad, CA) according to manufactures instructions. After transfection, cells were processed for specific experiments as previously reported [14 (link), 17 (link), 24 (link)].

Specific silencing of VRK1 was performed using two different siRNA from Dharmacon (DHARMACON RNA Technologies). The VRK1 sequences targeted by these siRNA oligonucleotides were siVRK1-02 (siV1-02), CAAGGAACCTGGTGTTGAA; and siVRK1-03 (siV1-03): That GGAAUGGAAAGUAGGAUUA. As negative control, the “ON-TARGETplus siCONTROL Non-targeting siRNA” from DHARMACON was used and is indicated as siCt in experiments. The efficiency of RNAi transfection was determined with “siGLO RISC-free siRNA” (DHARMACON). Briefly, cells were transfected with the indicated siRNA at a concentration of 20 nM using Lipofectamine 2000 Reagent (Invitrogen) or Lipotransfectin (Nivorlab) [18 (link),34 (link),74 (link)]. After transfection, cells were processed at the times indicated in specific experiments that were performed as previously reported [19 (link),77 (link)]. The depletion of VRK1 by siRNA has been previously reported for A549 [18 (link),21 (link),36 (link)] and HT144 [20 (link),21 (link)] cell lines.

VRK1 knockdown was performed using three different siRNA specific for VRK1 (Accession number NM_003384): siVRK1-01 (siV-01), siVRK1-02 (siV-02), siVRK1-03 (siV-03) and siVRK1-09 (siV-09) (all from Dharmacon RNA Technologies- GE Healthcare). The sequences targeted by these VRK1 siRNA oligonucleotides were siVRK1-01: GAAAGAGAGTCCAGAAGTA; siVRK1-02: CAAGGAACCTGGTGTTGAA; si-VRK1-03: GGAAUGGAAAGUAGGAUUA; and siVRK1-09: AGGUGUACUUGGUAGAUUA. As negative control the “ON-TARGETplus siCONTROL Non-targeting siRNA” (siCt) (Dharmacon) was used. The efficiency of RNAi transfection was determined with “siGLO RISC-free siRNA” (DHARMACON) labelled with a red fluorochrome. All of them have been previously used34 (link)48 (link)51 (link).
Briefly, cells were transfected with the indicated siRNA at a concentration of 20 nM using Lipofectamine 2000 Reagent” (Invitrogen) according to manufacturer instructions. After transfection cells were processed for specific experiments at the times indicated in them. For rescue experiments, cells were transfected with the indicated siRNA using Lipofectamine 2000 Reagent, and 36 hours later, cells were retransfected with plasmids using JetPI reagent (Poly Plus, Ilkirch, France) according to manufacturer instructions. Targeted protein and plasmid expression were analysed thirty-six hours after the second transfection51 (link).

Cultured mouse trigeminal neurons were transfected with specific siRNA BNP (siBNP) oligonucleotides (Sigma), or siCdk5 oligonucleotide (ThermoFisher Scientific, Milan, Italy) using the DharmaFECT transfection reagent (Dharmacon, Lafayette, CO, USA). As control (“scramble”), cells were transfected with siGLO RISC-Free siRNA (Dharmacon). The BNP siRNA and control siRNA were transfected at a final concentration of 100 nM for 24 h in triplicate for each treatment. At 48 h post-transfection, BNP knockdown was confirmed by immunostaining and Elisa assay. A pool of two different oligonucleotide sequences were used to knockdown BNP (NM_008726) expression, as previously published [76 (link)]: BNP siRNA-1: sense 5′-CCCAGAGACAGCUCUUGAATT-3′ with antisense 5′-UUCAAGAGCUGUCUCUGGGTT-3′, and BNP siRNA-2: sense 5′-GGCACAAGAUAGACCGGAUTT-3′ with antisense 5′-AUCCGGUCUAUCUUGUGCCTT-3′. To knockdown Cdk5 expression (NM_007668.3), siCdk5 or control siRNA sequences were transfected at a final concentration of 100 nM. Twenty-four hours after silencing, cells were used for protein expression and patch clamping experiments. Efficiency of Cdk5 silencing was tested with Western blot.

CST-Abl-expressing 4T1 cells lacking expression of p53 were generated using SMARTpool siRNAs (50 nM) according to the manufacturer's recommendations (Dharmacon, Lafayette, CO) and as previously described [86 (link)]}. Ninety-six hr post-transfection, the cells were harvested and total RNA was isolated to monitor the expression of p21 mRNA by semi-quantitative real-time PCR as described above. CST-Abl cell transfection efficiency was monitored by co-transfection with siGLO RISC-Free siRNA (Dharmacon), which was visualized using fluorescent microscopy.