Sequence detection system 7900 abi prism 7900ht

Manufactured by Thermo Fisher Scientific

Sourced in United States

The Sequence Detection System 7900 (ABI Prism 7900HT) is a real-time PCR instrument designed for gene expression analysis and genetic variation studies. The system utilizes TaqMan technology to detect and quantify nucleic acid sequences. It features a 96-well format and supports a wide range of sample volumes and reaction chemistries.

Automatically generated - may contain errors

Lab products found in correlation

Power sybr green pcr master mix, by Thermo Fisher Scientific (4 mentions) Trizol reagent, by Thermo Fisher Scientific (3 mentions) Thermoscript rt system reagent, by Thermo Fisher Scientific (3 mentions) Trizol reagent kit, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

ABI Prism 7900HT (708 citations) ABI PRISM 7900 Sequence Detection System (493 citations) ABI Prism 7900 (312 citations) ABI 7900 system (209 citations) ABI PRISM 7900HT system (140 citations) ABI 7900HT system (132 citations) ABI PRISM 7900 system (113 citations) ABI 7900 Sequence Detection System (88 citations) Prism 7900HT (73 citations) 7900 Sequence Detection System (52 citations)

4 protocols using sequence detection system 7900 abi prism 7900ht

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were harvested, and total RNA was extracted using TRIzol Reagent (Gibco BRL, Gaithersburg, MD). RNA was reverse transcribed to cDNA with Thermoscript RT system reagent (Gibco BRL) in accordance with the manufacturer’s instructions.
Quantitative real-time PCR was performed using an Applied Biosystems Sequence Detection System 7900 (ABI Prism 7900HT, Applied Biosystems Company, USA) with a 10-µl mixture consisting of Power SYBR GREEN PCR Master Mix (Applied Biosystems, Foster City, CA), 500 nmol of each primer, and 300 ng of cDNA templates. The reactions were performed with an initial denaturation at 95 °C for 5 minutes, which was followed by 60 cycles of 20 seconds at 94 °C, 20 seconds at 60 °C, and 40 seconds at 72 °C. A final extension at 72 °C for 5 minutes was included before a temperature ramp from 72 °C to 95 °C at 0.1 °C/s with continuous fluorescent acquisition. Each cDNA sample was duplicated for each q-RT-PCR attempt, and the average relative fold mRNA expression levels were determined using the 2^−ΔΔCt method; GAPDH was the internal control. The oligonucleotide primers for FOXK1, SNAI1, SNAI2, KLF8, Sp1, Sp3, YY1, HMGA1 and GAPDH mRNA are listed in Supplementary Table 1.

Xie R., Wang J., Liu X., Wu L., Zhang H., Tang W., Li Y., Xiang L., Peng Y., Huang X., Bai Y., Liu G., Li A., Wang Y., Chen Y., Ren Y., Li G., Gong W., Liu S, & Wang J. (2017). RUFY3 interaction with FOXK1 promotes invasion and metastasis in colorectal cancer. Scientific Reports, 7, 3709.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were harvested, and total RNA was extracted using Trizol Reagent (Gibco BRL, Gaithersburg, MD). RNA was reverse transcribed to cDNA by Thermoscript RT system reagent (Gibco BRL) in accordance with the manufacturer's instructions.
Quantitative real-time PCR was performed using an Applied Biosystems Sequence Detection System 7900 (ABI Prism 7900HT, Applied Biosystems Company, USA) with a 10- μl mixture composed of Power SYBR GREEN PCR Master Mix (Applied Biosystems, Foster City, CA), 500 nmol of each primer, and 300 ng of cDNA templates. The reactions were performed with initial denaturation at 95°C for 5 minutes followed by 60 cycles of 20 seconds at 94°C, 20 seconds at 60°C, and 40 seconds at 72°C. A final extension at 72°C for 5 minutes was included before a temperature ramp from 72°C to 95°C at 0.1°C/s with continuous fluorescent acquisition. Each cDNA sample was duplicated for each time of q-RT-PCR, and the average relative fold mRNA expression levels were determined using the 2^−ΔΔC_t method, with GAPDH as the internal control. The primers used are listed in Supplementary Table S1 [44 (link), 45 (link)].

Wu Y., Peng Y., Wu M., Zhang W., Zhang M., Xie R., Zhang P., Bai Y., Zhao J., Li A., Nan Q., Chen Y., Ren Y., Liu S, & Wang J. (2016). Oncogene FOXK1 enhances invasion of colorectal carcinoma by inducing epithelial-mesenchymal transition. Oncotarget, 7(32), 51150-51162.

+ Open protocol

+ Expand

Colorectal Mucosa RNA Extraction and qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Colorectal mucosa tissues, including cell lines, were used for total RNA extraction using Trizol reagent kit (Invitrogen, USA). Total RNA (1 μg) reverse transcription of RNA to cDNA was achieved by using the PrimeScript™ II kit (Gibco BRL) as outlined in the manufacturer's guidelines.
Applied Biosystems Sequence Detection System 7900 (ABI Prism 7900HT, Applied Biosystems Company, USA) was used to perform qPCR. The reaction included a 10 µL mix composed of Power SYBR GREEN PCR Master Mix (Applied Biosystems, Foster City, CA, USA), 300 ng of cDNA template, and 500 nmol of both forward and reverse primer. The following PCR conditions were used: Initial denaturation for 5 minutes at 94°C; and 30 rounds of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and elongation at 72°C for 1 minute. In each qRT PCR performed, each cDNA sample was prepared in duplicate, and the mean relative fold mRNA expression levels were evaluated with the 2^−ΔΔC_ttechnique using GAPDH as the internal control.
The following are the primer sequences for RT‐PCR: E‐cadherin forward 5'‐TGCCCAGAAAATGAAAAAGG‐3' and reverse 5'‐GTGTATGTGGCAATGCGTTC‐3' (200 bp); GAPDH forward 5'‐GTCAACGGATTTGGTCGTATTG‐3' and reverse 5'‐CTCCTGGAAGATGGTGATGGG‐3' (204 bp).

Liu M., Xiao Y., Tang W., Li J., Hong L., Dai W., Zhang W., Peng Y., Wu X., Wang J., Chen Y., Bai Y., Lin J., Yang Q., Wang Y., Lin Z., Liu S., Xiong J., Wang J, & Xiang L. (2020). HOXD9 promote epithelial‐mesenchymal transition and metastasis in colorectal carcinoma. Cancer Medicine, 9(11), 3932-3943.

+ Open protocol

+ Expand

Quantitative Real-Time PCR for Vimentin Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were harvested, and total RNA was extracted using TRIzol Reagent (Gibco BRL, Gaithersburg, MD, USA). RNA was reverse-transcribed to cDNA using Thermoscript RT system reagent (Gibco BRL) in accordance with the manufacturer's instructions.
Quantitative real-time PCR was performed using an Applied Biosystems Sequence Detection System 7900 (ABI Prism 7900HT, Applied Biosystems Company, USA) with a 10-µl mixture composed of Power SYBR GREEN PCR Master Mix (Applied Biosystems, Foster City, CA, USA), 500 nmol of each primer, and 300 ng of cDNA template. The reactions were performed with an initial denaturation at 95°C for 5 minutes, followed by 60 cycles of 20 seconds at 94°C, 20 seconds at 60°C, and 40 seconds at 72°C. A final extension at 72°C for 5 minutes was included before a temperature ramp from 72°C to 95°C at 0.1°C/s with continuous fluorescent acquisition. Each cDNA sample was processed in duplicate for each q-RT-PCR assay, and the average relative fold mRNA expression levels were determined using the 2 -ΔΔCt method with GAPDH as the internal control. The primer sequences used for q-RT-PCR were as follows: Vimentin forward: 5'-GGGACCTCTACGAGGAGGAG-3' and Vimentin reverse: 5'-CGCATTGTCAACATCCTGTC-3' (200 bp); GAPDH forward: 5'-GTCAACGGATTTGGTCGTATT-3' and GAPDH reverse: CTCCTGGAAGATGGTGATGGG (216 bp).

Wang J., Liu G., Liu M., Xiang L., Xiao Y., Zhu H., Wu X., Peng Y., Zhang W., Jiang P., Li A., Nan Q., Chen Y., Chen C., Cheng T., Liu S, & Wang J. (2018). The FOXK1-CCDC43 Axis Promotes the Invasion and Metastasis of Colorectal Cancer Cells. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 51(6).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!