Taq dna polymerase

Chemicals were purchased from Carl Roth (Karlsruhe, Germany) or Sigma-Aldrich (Taufkirchen, Germany) if not otherwise stated. NucleoSpin DNA purification kits were supplied by Macherey-Nagel (Düren, Germany). Pfu HF DNA polymerase, Taq DNA polymerase, and the GeneMorph II Random Mutagenesis kit were obtained from Agilent Technologies (Santa Clara, CA, USA). Phusion High-Fidelity DNA Polymerase and Dpn I were obtained from New England Biolabs (Ipswich, MA, USA).

Pea cDNA library was constructed as described earlier [40 (link)]. In our recent study, PschSOD was found to be an interacting partner of PDH45 [41 (link)]. Complete sequence of this PschSOD matched with earlier reported SOD from pea (NCBI Accession no. CAA39819). Gene specific primers were designed using Primer 3 software. NdeI restriction site was inserted prior to PschSOD F (5′CATATGGCTGCCAAGAAAGCCGTCGCTG3′) and BamHI restriction site was inserted after PschSOD R (5′GGATCCTTATACTGGAGTCAAGCCAACC3′). Using pea cDNA library as template, PCR reactions were carried out in a final volume of 50 μl containing 5 μl 10X taq buffer (Agilent Technologies); 200 μM of dNTPs; 0.2 ng of each primer; 5 units of Taq DNA polymerase (Agilent Technologies). The PCR program used was as follows: 95°C for 5 min (1 cycle), 94°C for 30 s, 58°C for 30 s, 72°C for 1 min (32 cycles), and 72°C for 10 min (1 cycle). PCR product was separated on agarose gel. The expected band was excised from gel and purified using Midi gel extraction column (Advanced Microdevices Pvt. Ltd.). Using TA cloning vector, insert was cloned in pGEM-T easy vector. Confirmation of primary cloning of PschSOD -pGEM®-T by colony PCR and restriction digestion is shown in Additional file 1: Figure S1A.

Total RNA was isolated from OTCD hepatocytes with the PureLink RNA extraction kit (Life Technologies). Complementary DNA (cDNA) was synthesized with PrimeScript Reverse Transcriptase (Takara) according to the manufacturer’s instructions. OTC transcripts were amplified with Pfu Ultra II Fusion HS DNA polymerase (Agilent Technologies) from exon 1 to exon 5 with forward primer 5′-GAAGATGCTGTTTAATCTGAGG and reverse primer 5′-CTGGAGCGTGAGGTAATCAGCC, and from exon 5 to exon 10 with forward primer 5′-GCAGATGCAGTATTGGCTCG and reverse primer 5′-CCCATACCACGTGTTAGGGATT, as described previously.²⁸ (link) The suspected region containing the disease-causing OTC variant was amplified with forward primer 5′-TCTCATCCTCATGTCCAAAGTGTT and reverse primer 5′-TATGTAAAGCCACACCCACAGAC with Taq DNA Polymerase (NEB), and Sanger sequenced. Geneious version 8.1.9 was used for primer design, sequence view, alignment, and illustration throughout the study.