Asf1b

Manufactured by Cell Signaling Technology

ASF1B is a histone chaperone protein that plays a role in chromatin assembly and disassembly. It is involved in the deposition of histones onto DNA during DNA replication and repair.

Automatically generated - may contain errors

Lab products found in correlation

Brca1, by Santa Cruz Biotechnology (1 mentions) Asf1a, by Cell Signaling Technology (1 mentions) Brca1 sirna, by Qiagen (1 mentions) Lenticrispr v2, by Addgene (1 mentions) β tubulin, by Merck Group (1 mentions) Vinculin, by Merck Group (1 mentions) γh2ax, by Merck Group (1 mentions) Flag tag (flag), by Merck Group (1 mentions) Rad51, by Abcam (1 mentions) Foxm1, by Cell Signaling Technology (1 mentions) Ki 67 d2h10, by Cell Signaling Technology (1 mentions) Brca1, by Merck Group (1 mentions) Cyclin a, by Santa Cruz Biotechnology (1 mentions) β trcp, by Cell Signaling Technology (1 mentions) Protein g conjugated agarose beads, by GE Healthcare (1 mentions) Cyclin e, by Santa Cruz Biotechnology (1 mentions)

3 protocols using asf1b

Chromatin Dynamics in DNA Damage Response

Check if the same lab product or an alternative is used in the 5 most similar protocols

Antibodies used in this study are 53BP1 (catalog no.: NB100-304; Novus Biologicals), RIF1 (catalog no.: 95558S; Cell Signaling Technology), BRCA1 (catalog no.: sc-6954; Santa Cruz Biotechnology), ASF1A (catalog no.: 2990S; Cell Signaling Technology), ASF1B (catalog no.: 2902S; Cell Signaling Technology), Vinculin (catalog no.: V9131; MilliporeSigma), FLAG (catalog no.: F3165; MilliporeSigma), β-tubulin (catalog no.: T5168; MilliporeSigma), RAD51 (catalog no.: ab63801; Abcam), γH2AX (catalog no.: 05-636l; MilliporeSigma), and RPA2 (catalog no.: 2208S; Cell Signaling Technology).
siRNAs used in this study are control siRNA (catalog no.: 1022076; Qiagen), BRCA1 siRNA (catalog no.: SI02664361; Qiagen), ASF1A siRNA (catalog no.: SI04270182; Qiagen), ASF1B siRNA (catalog no.: SI04278414; Qiagen), ON-TARGETplus Human ASF1A siRNA (catalog no.: L-020222-02-0005; Dharmacon), and ON-TARGETplus Human ASF1B siRNA (catalog no.: L-020553-00-0005; Dharmacon). sgRNAs used in this study for knockdown experiments were ligated to LentiCRISPR V2 (catalog no.: 52961; Addgene) vector. sgRNA sequences are RIF1 sgRNA: GCAGACATTTCCCTCTGAAG; ASF1A sgRNA: CTAATTACTTGTACCTATCG; and ASF1B sgRNA: CTCCTGTCCATGGTAGGTGC.

Tang M., Chen Z., Wang C., Feng X., Lee N., Huang M., Zhang H., Li S., Xiong Y, & Chen J. (2022). Histone chaperone ASF1 acts with RIF1 to promote DNA end joining in BRCA1-deficient cells. The Journal of Biological Chemistry, 298(6), 101979.

+ Open protocol

+ Expand

Quantitative Protein Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

TMAs were kindly provided by the Neuropathology lab of HSM-CHULN. Protein levels were assessed by immunohistochemical (IHC) staining with UBE2C antibody (Boston Biochem, Cat# A650), ASF1B (Cell Signaling Technology, Cat# 2902), FoxM1 (Cell Signaling Technology, Cat# 5436)or Ki-67 (D2H10) (Cell Signaling Technology, Cat# 9027). For UBE2C, ASF1B and FoxM1 we used semi-quantitative scores of intensity (low or high staining intensity) and frequency (low: 0%-49% staining or high: 50%-100% staining), performed by two independent researchers and validated by a pathologist. For Ki67, an automated software was used to quantify the percentage of positive nuclei (ImmunoRatio).

Paisana E., Cascão R., Custódia C., Qin N., Picard D., Pauck D., Carvalho T., Ruivo P., Barreto C., Doutel D., Cabeçadas J., Roque R., Pimentel J., Miguéns J., Remke M., Barata J.T, & Faria C.C. (2023). UBE2C promotes leptomeningeal dissemination and is a therapeutic target in brain metastatic disease. Neuro-Oncology Advances, 5(1), vdad048.

+ Open protocol

+ Expand

Immunoprecipitation and Immunoblotting Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

For immunoprecipitation, whole-cell extracts from cells were resuspended in buffer containing 20 mM Tris-HCl (pH 7.5), 100 mMNaCl, 1% Nonidet P-40, 5% glycerol, 1 mM EDTA, 1 mM MgCl₂, 1 mM ATP, 1 mM DTT, 10 mM NaF, 1 mM sodium vanadate, and protease inhibitors. One milligram of total cell extract was incubated with the indicated antibodies and immunoprecipitated with protein G-conjugated agarose beads (GE Healthcare). For immunoblotting, ∼30–50 μg of protein was subjected to SDS-PAGE analysis. Antibodies against each protein were purchased from the following companies: CHK1, Cyclin A, Cyclin E, CUL1, and CAF1 from Santa Cruz Biotechnology; p-CHK1(Ser345), ASF1a, ASF1b, and βTRCP from Cell Signaling Technology; ATR from Affinity Bioreagent; ATM from Novus Biological; and BRCA1 from Milipore.

Im J.S., Keaton M., Lee K.Y., Kumar P., Park J, & Dutta A. (2014). ATR checkpoint kinase and CRL1βTRCP collaborate to degrade ASF1a and thus repress genes overlapping with clusters of stalled replication forks. Genes & Development, 28(8), 875-887.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!