For stable cell line construction, lentivirus and shRNAs productions were completed by Hanbio Biotechnology Co., Ltd. (Shanghai, China) and used according to the manufacturer’s protocols. Briefly, cells were transfected with concentrated virus at a multiplicity of infection of 20 with polybrene for 6 h and then 1:1 fresh medium was added for the following 18 h. Expression of target genes in the infected cells was validated by qRT-PCR and western blot.
Shrna
Manufactured by Hanbio Biotechnology
Sourced in China
ShRNA is a type of laboratory equipment used for gene silencing. It functions by producing short hairpin RNA molecules that target and degrade specific messenger RNA sequences, thereby reducing the expression of targeted genes.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine imax kit, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 3000 kit, by Thermo Fisher Scientific (1 mentions)
Sirna, by RiboBio (1 mentions)
Lipofiter transfection reagent, by Hanbio Biotechnology (1 mentions)
Fibronectin, by Abcam (1 mentions)
Caspase 3 assay kit, by Thermo Fisher Scientific (1 mentions)
Phosphorylated p ampk, by Cell Signaling Technology (1 mentions)
α sma, by Abcam (1 mentions)
Soluble collagen assay kit, by Abcam (1 mentions)
Total collagen assay kit, by Abcam (1 mentions)
Malondialdehyde mda assay kit, by Abcam (1 mentions)
Elisaplus kit, by Roche (1 mentions)
Compound c, by Selleck Chemicals (1 mentions)
β actin, by Cell Signaling Technology (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
1640 medium, by Thermo Fisher Scientific (1 mentions)
Sirna, by Qiagen (1 mentions)
Lentivirus, by Hanbio Biotechnology (1 mentions)
Opti mem medium, by Thermo Fisher Scientific (1 mentions)
Polybrene, by GenePharma (1 mentions)
11 protocols using shrna
1
Robust Lentiviral Transduction for Stable Cell Lines
2
Modulating circDCUN1D4 and Associated Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
shRNAs targeting the junction region of the circDCUN1D4 sequence, circDCUN1D4-overexpressing plasmids, HuR-overexpressing plasmids, and TXNIP-overexpressing plasmids were synthesized by Hanbio (Shanghai, China). The primers are provided in Table S2 . The siRNAs targeting TXNIP, DHX9, and ADAR1 were provided by RiboBio (Guangzhou, China). The target sequences are supplied in Table S3 . The sequences of AluJo + AluSc, AluJo, AluSc, and vector were constructed by sequencing synthesis and subcloned into pcDNA3.1(+) (Public Protein/Plasmid Library, Nanjing, China). Transient transfection of the shRNA or the overexpressing plasmids was performed using the Lipofectamine 3000 kit (Invitrogen), according to the manufacturer’s instructions, and transient transfection of siRNA was performed using the Lipofectamine iMax kit (Invitrogen), according to the manufacturer’s instructions.
3
Lentiviral Overexpression and Knockdown of HuR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human HuR coding region was amplified by polymerase chain reaction (PCR) using a primer pair specific to HuR. The fragments were inserted into the lentiviral expression vectors (LV-HuR) and then packaged into viral particles. The negative control lentiviral (LV-NC) was constructed by not inserting any sequences. Lentivirus silencing HuR through shRNAs were obtained from Hanbio Biotechnology (containing RFP). The targeting sequences of shRNA control (sh-NC) and four shRNA targeting HuR (sh-HuR-1, sh-HuR-2, sh-HuR-3 and sh-HuR-4) are listed in Table SI .
4
Plasmid Transfection in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were seeded in 6-well plates at a density of 2×105/well and cultured at 37°C in an incubator overnight. The overexpressing plasmid and silencing shRNAs (Hanbio, Shanghai, China) were transfected into the cells by using LipoFiter transfection reagent (Hanbio) in a serum-free medium. Cells were changed to complete the medium at 6 hours after transfection and cultured for another 30 hours. The target sequences of shRNAs were provided in Table 1 .
5
Comprehensive Metabolic Assays for Cellular Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Enzyme-linked immunosorbent assay (ELISA) assay including lactate dehydrogenase (LDH), creatine kinase MB isoenzyme (CK-MB), were purchased from MyBioSource (CA, United States). PKA (protein kinase A) colorimetric activity kit. Dihydrodichlorofluorescein diacetate (DCF-DA) and caspase-3 assay kit were obtained from ThermoFisher Scientific (CA, United States). Total antioxidant capacity (TAOC) assay kits, total superoxide dismutase (SOD) activity assay kits, malondialdehyde (MDA) assay kits, 3-nitrotyrosine (3-NT) assay kits, and 8-hydroxy 2 deoxy guanosine (8-OHdG) assay kits were purchased from Abcam (Cambridge, United Kingdom). ELISAPLUS kit was purchased from Roche Applied Science (Mannheim, Germany). Caspase 3/7 activity using a kit from Promega (WI, United States). Total collagen assay kit and soluble collagen assay kit were purchased from Abcam (Cambridge, United Kingdom). Phosphorylated (P−) AMPK, total (T−) AMPK, antibodies, and β-actin were purchased from Cell Signaling Technology (MA, United States). p53, cAMP, PKA, NRF2, HO-1, α-SMA, fibronectin, and phosphodiesterase 4D (PDE4D) were purchased from Abcam (Cambridge, United Kingdom). Compound C was obtained from Selleck Chemicals (Texas, United States). An AAV9 system harboring shPDE5D, shRNA, miR-223-3p mimic, miR-223-3p mimic inhibitor, or negative control was generated by HanBio Technology (Shanghai, China).
6
Transfection of Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 769-P and ACHN cell lines were seeded overnight in 6-well plates as well as transfected with shRNA (Hanbio Biotechnology Co., Ltd, Shanghai, China) at 60% Lipofectamine 3000 (Invitrogen CA, USA) following the manufacturer's instructions. After 48 h of subincubation, the cells were harvested and applied to further experiments.
7
Lentiviral-Mediated PDCD4 Modulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The recombinant lentivirus carrying the PDCD4 gene or specific short hairpin RNA (shRNA) against PDCD4, as well as the corresponding negative controls, were obtained from Hanbio Co. Ltd. (Shanghai, China). The lentivirus was then transduced into HSC as we described previously.8 (link) Subsequently, transduced Lin- SCA1+c-KIT+ (LSK) cells (6×103) were purified with GFP expression through flow cytometry, and transplanted into 10.0 Gy-irradiated CD45.1+WT recipients along with 5×105 CD45.1+ competitor BM cells. The sequence of sh-PDCD4 is as follows: 5’-GAGCTTGTATATGAAGCCATTGTAA- 3’.
8
Integrin β1 Knockdown in ESCC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Details of cell lines used in this study have been described previously29 (link). The KYSE150 and KYSE180 ESCC cell lines were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium (11875119, Invitrogen Life Technologies, USA) with 10% fetal bovine serum (10099141C, Invitrogen). All cells were incubated at 37°C in a humidified atmosphere containing 5% CO2. Cells were tested to ensure they were mycoplasma-negative. Integrin β1 was knockdown by siRNA transfection or lentiviral infection. 48 hrs after virus transfection, stably transfected cell strains were screened with puromycin (500ng/mL), and the transfection efficiency was verified by Western blot assay. siRNA (Qiagen, Germany) and shRNA (Hanbio, China) targeting Integrin β1 contained the following sequence: 5'- ACAGATGAAGTTAACAGTGAA -3'.
9
Lentiviral Transfection of SLC26A9
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SW48 and COLO201 cells were transfected with lentivirus carrying the SLC26A9 gene fragment, shRNA, or empty vector (Hanbio Biotechnology, China). A stable strain was selected by puromycin. RT‒qPCR and western blot analyses were performed to validate the transfection efficiency.
10
Modulation of LHPP Expression in Pancreatic Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The synthesized overexpression vector of LHPP (LHPP) and negative control (Vector) were annealed and ligated into the pGLVH1/RFP/Puro plasmid, and the overexpression vector of the human LHPP sequence (NM_001167880.2) was bought from GenePharma (Shanghai, China). For LHPP knockdown (shLHPP), shRNA against LHPP was designed by Hanbio (Shanghai, China), and the lentivirus without the transgene was produced in the same manner and used as a negative control (NC). The shLHPP sequence was 5′-CCGCTCAGAATTTGATCAGAT-3′. Transfection of the LHPP and shLHPP groups was performed in OptiMEM medium (Life Technologies) using Polybrene (GenePharma) when cells reached 30–50% confluence, in accordance with the manufacturer’s protocols. After the lentivirus vector was transfected into the BxPC-3 and AsPC-1 cells, the stable cell lines were obtained with puromycin treatment for 2 weeks. For the AKT activator, SC79 was bought from MedChemExpress. The LHPP group cells were pretreated with SC79 in 8 μg/ml.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!