Whole mount E10.5 embryos were labeled with anti-β3Tubulin (Biolegend Cat# 801201 1:1000) and were subsequently imaged by confocal microscopy. Images were analyzed using FIJI/ImageJ (NIH). The cell bodies to be quantified were defined by drawing a line parallel to the last branch of the hypoglossal nerve extending across the length of the image. The hypoglossal nerve was chosen as an anatomical landmark because its morphology was unaffected in mutant embryos and served as an independent reference point so measurements were consistent across embryos. The area and distance migrated of cell bodies and axons rostral to the hypoglossal branch were measured using a freehand selection tool in FIJI/ImageJ. The multipoint cell counting tool was used on FIJI/ImageJ to count the number of axon bundles branching off the C1 DRG. A two-sided Student's t-test was performed to test for significance.
Anti β3 tubulin
Manufactured by BioLegend
Sourced in United States
Anti-β3-tubulin is a monoclonal antibody that specifically binds to the β3 isoform of tubulin, a key structural component of microtubules. This antibody can be used to detect and quantify the expression of β3-tubulin in various biological samples.
Automatically generated - may contain errors
Lab products found in correlation
Syto 16, by Thermo Fisher Scientific (1 mentions)
Goat anti sox2 antibody, by R&D Systems (1 mentions)
Anti map2, by BioLegend (1 mentions)
Vimentin, by Cell Signaling Technology (1 mentions)
Anti kv4, by Proteintech (1 mentions)
Kainic acid, by Bio-Techne (1 mentions)
Odyssey fc imaging system, by LI COR (1 mentions)
4 protocols using anti β3 tubulin
1
Quantifying Neuronal Migration and Axonal Branching
2
SHIELD-Processed Organoid Staining
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SHIELD-processed and cleared organoids were stained using an adapted version of the eFLASH protocol27 (link),44 (link). We incubated organoids in eFLASH sample overnight at room temperature. Organoids were then placed in the SmartLabel system (LifeCanvas) with 1.4 mL sample buffer in the sample cup. For SCOUT pipeline, we added 6µL Syto16 (1 mM solution, ThermoFischer #S7578), 15 µg goat anti-SOX2 antibody (R&D Systems #AF2018), 10 µg Fab fragment anti-goat IgG Alexa Fluor 594 (Jackson ImmunoResearch #805-587-008), 30 µg rabbit anti-TBR1 Alexa Fluor 647 (Cell Signaling Technology #45664S). Additional antibodies used for whole organoid staining are anti-β3-tubulin (mouse monoclonal, Biolegend #657408), anti-MAP2 (mouse monoclonal, Biolegend #801803) and vimentin (rabbit monoclonal, Cell Signaling Technologies #45664). All antibodies used in this study are listed in Supplementary Table 1 .
3
Antibody Characterization and Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following antibodies were used in this study: mouse monoclonal anti-Ago2/eIFC2 (catalog #H00027161-M01, Abnova; RRID:AB_565459 ); rabbit polyclonal anti-Kv4.2 (catalog #21298–1-AP, Proteintech Group; RRID:AB_10733102 ); and rabbit polyclonal anti-β3-tubulin (catalog #USA-802001, BioLegend; RRID:AB_2564645 ). Secondary antibodies for Western blot detection with chemiluminescence were obtained from GE Healthcare Life Sciences. The following quantitative real-time PCR (qRT-PCR) primers were used: Kv4.2: forward, GCTTTGAGACACAGCACCAC ; reverse, TGTTCATCGACAAACTCATGG ; Kcnq2: forward, AAATCTGGACTCACCTTCAGGA ; reverse, CACGGTCTGCCTTTACTTGG ; Kcnq3: forward, CCAGCTGCGGAACTCATC ; reverse, CAACCTGTTGGGGTTGGTAG ; Gapdh: forward, CAAGGTCATCCATGACAACTTTG ; reverse, GGGCCATCCACAGTCTTCTG ; miR-324-5p: CGCATCCCCTAGGGCATTGGTGT ; and RU19: GAGATCGTGTTACACTGTTGG . In vivo antagomirs were custom-made by Qiagen using the following sequences: miR-324-5p, ACCAATGCCCTAGG; and scrambled ACGTCTATACGCCCA . Both antagomirs had the same amount of locked nucleic acid (LNA)-modified nucleotides within the sequence as well as a partial phosphorothioate backbone. Kainic acid (catalog #0222, Tocris Bioscience) was dissolved at 2 mg/ml in sterile saline.
4
Sarm1 Protein Detection in Transgenic Mouse Brains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse brains from transgenic animals were lysed by dounce homogenization in cold RIPA buffer (50 mM Tris–HCl pH7.4, 1 mM EDTA, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 150 mM NaCl, 1 mM phenylmethylsulfonyl fluoride, and protease inhibitor cocktail from Prometheus). Brain extracts were sonicated for 20 s then centrifuged at 5000×g for 5 min at 4 °C. Supernatants were collected and subjected to a second round of centrifugation to remove excess cell debris. The supernatant was mixed with laemmli buffer and 15 µg protein separated by SDS-PAGE. Endogenous Sarm1 and β3-tubulin were detected by western immunoblotting (anti-Sarm1, 1:500, Biolegend # 696602; anti-β3-tubulin, 1:5000, BioLegend #657409). Primary antibodies were detected with a DyLight 680-conjugated goat anti-mouse secondary (1:5000, Invitrogen #35519) and visualized with a LiCor Odyssey Fc imaging system.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!