Reporter transgenes of CAG.GFP.WPRE.pA, CAG.RFP.pA, GRK1.GFP.pA, or EFS.GFP.WPRE.pA were cloned between AAV2 inverted terminal repeats. The general protocol used for AAV production has been previously detailed.33 Briefly, a standard polyethylenimine triple transfection method of HEK293T cells in Corning HYPERFlasks provided transgene plasmid, pAdDeltaF6, and one of the following: pRep2Cap2 Y444F, quad mutant, 7m8, or pRep2Cap8 Y733F. For AAV5 production, pDP5 (PlasmidFactory, Bielefeld, Germany) containing combined helper and rep and cap genes was used. Cells were harvested 72 hours post-transfection, and lysates were purified using iodixanol gradients with subsequent buffer exchange performed using Amicon Ultra-15 100K filter units (Merck, Kenilworth, NJ). AAV preparations were eluted in no Mg2+, no Ca2+ phosphate buffered saline with 0.001% Pluronic F68 (Thermo Fisher Scientific). DNase-treated samples were used for quantitative polymerase chain reaction (qPCR) titer with iTaq reagent (Bio-Rad Laboratories, Hercules, CA) and primers binding the pA sequence common to all transgenes (pA qPCR FW: CCAGCCATCTGTTGTTTGCC; pA qPCR RV: GAAAGGACAGTGGGAGTGGC).
Itaq reagent
Manufactured by Bio-Rad
ITaq is a DNA polymerase-based reagent used for DNA amplification. It is designed for reliable and efficient PCR amplification of DNA templates.
Automatically generated - may contain errors
3 protocols using itaq reagent
1
Optimized AAV Production for Gene Transfer
2
Quantitative PCR Analysis of Heat Shock Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell culture and treatments were performed as described above. Cell lysis and RNA extraction was performed using the Qiagen RNeasy Plus Mini Kit (Qiagen, Germantown, MD) according to the manufacturers instructions. Total RNA concentration was measured spectrophotometrically and equal concentrations were added to each well of a 96-well PCR plate. RT-qPCR was performed using the Bio-Rad iTaq reagent in a Bio-Rad CFX96 (Bio-Rad, Hercules, CA). Hsp90 probe sequence (5′ to 3′) TTCAGACAGAGCCAAGGTGC, Hsp27 probe sequence GGCATTTCTGGATGTGAGCC, and GAPDH probe sequence GGGAGCCAAAAGGGTCATCATCTC. Data analysis was performed with the manufacturer-supplied software.
3
Quantifying Checkpoint Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The amount of 0.5μg of oligo DT and 16μL RNase free water added to 5μgr of whole RNA and incubated for 10 minute. RNA extraction was performed using the Qiagen RNeasy Plus Mini Kit (Qiagen, Germantown, MD) according to the manufacturers instructions. Total RNA concentration was measured spectrophotometrically and equal concentrations were added to each well of a 96-well PCR plate. RT-qPCR was performed using the BioRad iTaq reagent in a Bio-Rad CFX96 (Bio-Rad, Hercules, CA). The primers for SYBR Green real-time PCR were designed specific for each checkpoint gene and for ACTB gene (β-actin) as internal control. The assays were repeated in their entirety for each measurement. Reverse Transcription is carried out with the Super Script First-Strand Synthesis System for RT-PCR. The following procedure is based on following to the manufacturers instructions, (total RNA 5 μg, random hexamers (50 ng/ μl) 3 μl, 10 mM dNTP mix 1 μl, DEPC H2O to 10 μl). Comparison of the results between various experimentally treated groups and their corresponding controls was carried out by SPSS .20 software with t-test and pearson chi-square. All comparisons were considered significant when p < 0.05.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!