Qiamp blood mini extraction kit

DNA was extracted from peripheral leukocytes by Qiamp Blood Mini extraction kit (Qiagen Valencia, CA). The variant CTTTA pentanucleotide insertion was screened by polymerase chain reaction (PCR) by amplifying a 114/119 bp region of LEPR gene using 5' mismatch primer ATAATGGGTAATATAAAGTGTAATAGAGTA and 3' primer AGAGAACAAACAGACAACATT in a thermal cycler (Eppendorf Hamburg, Germany). PCR cycling conditions comprised of an initial denaturation for 7 min at 95°C followed by 30 repeats (30 sec each) at 95°C, 55°C and 72°C and a final extension step of 7 min at 72°C. Amplified products were verified by electrophoresis using 2% agarose gel. 10 μl aliquots of the amplified products were digested overnight at 37°C with the restriction enzyme Rsa I (Fermentas). Digested products were resolved on 4% agarose gel and cleavage products were visualized by ethidium bromide staining. Deletion genotype was not amenable to restriction digestion and resolved as a single 114 bp band whereas the Insertion genotype was digested by Rsa I enzyme yielding 90 bp and 29 bp fragments. Heterozygous Insertion/Deletion genotype was characterized by all three bands of 114 bp, 90 bp and 29 bp. Results were further validated by direct sequencing. Purification and Sequencing was done by Macrogen Inc.1001 World Meridian Venture Center. The genotypic results were in conformity with the sequencing analysis.