Murine leukemia virus reverse transcriptase

Cells treated with fucoxanthin were cultured for 24 hours. TRIzol reagent (Invitrogen, Carlsbad, CA) was used to extract total RNA. Reverse‐transcription used an oligo(dT) primer and Murine Leukemia Virus reverse transcriptase (Takara, Dalian, China) to obtained cDNA GAPDH was used as internal control. The following primers were used: GAPDH, 5′‐TGGCACCCAGCACAATGAA‐3′ and 5′‐CTAAGTCATAGTCCGCCTAGAAG CA‐3′; VEGF‐C, 5′‐ATTAGACGTTCCCTGCCAGC‐3′ and 5′‐TCCAGCTCCTTGTTTGGTCC‐3′; VEGFR‐3, 5′‐ATTCCCCATGACCCCAACGA‐3′ and 5′‐GTAAAA CACCTGGCCTCCTCG‐3′. Real‐time qPCR was performed in triplicate for every sample in a parallel design, using the SYBR^® Premix ExTaq^™ (Takara) and the Takara detection system TaKaRa TP800 (Dalian, China), according to the manufacturer's protocol. Subsequently, the genes expression data were analysed by Thermal Cycler Dice Real Time system software (Takara), and quantified by the comparative cycle threshold (Ct) method (2^−ΔΔCt method), based on the Ct values for among VEGFC, VEGFR3 and GAPDH to calculate the relative fold increase.

For RACE PCR, Foc4 cDNA was synthesized from RNA by reverse transcription-PCR (RT-PCR) with murine leukemia-virus reverse transcriptase (TaKaRa, Kyoto, Japan). Two primers were designed based on the N-terminal amino acid sequence of Pgc4. The 3′-RACE PCR was conducted using the primers pgc4-P1 (5′-ACNYTNCCNGCNGGNGT-3′) and pgc4-P2 (5′-GAYATHWSNGARTTYMGN-3′), along with Oligo (dT) 20 primers. The amplification conditions were as follows: 1 cycle of 3 min at 94 °C; 35 cycles of 30 s at 94 °C, 30 s at 52 °C, and 90 s at 72 °C; then 10 min at 72 °C. The amplified fragments were purified and sequenced.
Based on the sequence results of the RACE PCR, the gene sequences and coding sequences of Foc1 and Foc4 were obtained by RT-PCR using the primers pgc4-F1 (5′-ATGCGCTCCTTGCAAATTATTT-3′) and pgc4-R1 (5′-CTACTGTGGATGGAAAGCGCCC-3′). The amplification conditions were as follows: 1 cycle of 3 min at 94 °C; 35 cycles of 30 s at 94 °C, 30 s at 52 °C, and 90 s at 72 °C; then 10 min at 72 °C.
The nucleotide sequences of pgc4 from Foc4 and Foc1 have been deposited in the GenBank database under the accession numbers MT385837 and MT385838.