Peripheral blood samples were collected after obtaining written informed consent from the participants. Among the genetic variants of the CYP2C9 gene that are associated with warfarin dose, Asian populations do not have the CYP2C9*2 allele but the CYP2C9*3 allele [23 (link)]. Accordingly, genotyping of CYP2C9*3 and VKORC1 (-1639G>A) was performed. The genotypes of single-nucleotide polymorphisms were identified using TaqMan PCR system (Applied Biosystems, Foster City, CA, USA).
Taqman pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The TaqMan PCR system is a real-time polymerase chain reaction (PCR) technology developed by Thermo Fisher Scientific. It is designed to detect and quantify specific DNA sequences in a sample. The system utilizes fluorescent probes to monitor the amplification of target DNA sequences during the PCR process, providing real-time data on the amount of the target present.
Automatically generated - may contain errors
3 protocols using taqman pcr system
1
Pharmacogenetic Profiling of Warfarin
2
Quantification of Viral Genome Copy Number
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantification of viral genome copy number was achieved using the TaqMan PCR system provided by Applied Biosystems as previously described.50 (link) For VV quantification, the primers and probe were designed for the VV late transcription factor 1 (VLTF-1) gene as follows: forward, 5′-AACCATAGAAGCCAACGAATCC-3′ (code SY100203462-026), reverse, 5′-TGAGACATACAAGGGTGGTGAAGT-3′ (code SY100203462-027), and probe, 5′-ATTTTAGAACAGAAATACCC-3′. The primers were supplied by Sigma-Aldrich. The standard was VVL15 DNA, and 40 ng of DNA was used per sample as the template. Viral genome copy number was normalized by total DNA loaded. The PI3Kδ qPCR assay was carried out with a pre-designed kit from Applied Biosystems using PI3Kδ mouse cDNA as a standard.
3
Gene Expression Analysis of Dopaminergic Neurons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated with TRIzol reagent (Invitrogen) or RNeasy Mini Kit (Qiagen, Hilden, Germany), and cDNAs were generated with random hexamers using the PrimeScript RT Master Mix (Takara, Shiga, Japan) or the ReverTra Ace kit (Toyobo, Osaka, Japan). Real‐time PCR was performed using SYBR Green PCR system (Takara) or TaqMan PCR system (Applied Biosystems, Foster City, California). The primer sequences used were as follows: MAP2, 5′‐ccaatggattcccatacagg‐3′ and 5′‐tctccgttgatcccattctc‐3′, tyrosine hydroxylase (TH), 5′‐ccgtgctaaacctgctcttc‐3′ and 5′‐atggtggattttggcttcaa‐3′, DAT, 5′‐ttcatcatctacccggaagc‐3′ and 5′‐ggtgagcagcatgatgaaga‐3′, EN1, 5′‐aagccacaggcatcaagaac‐3′ and 5′‐ctcgctctcgtctttgtcct‐3′, GIRK2, 5′‐tagaggacccctcctggact‐3′ and 5′‐atctgtgatgacccggtagc‐3′, AADC, 5′‐gagctgggttaattggtgga‐3′ and 5′‐gtctctctccagggcttcct‐3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!