Bigdye v 3.1 terminator

This analysis was performed in 99 of the 500 cases from 458 families with (a) ≤3 family members with BC and/or OC (83.8%) and (b) index cases with early-onset BC (≤35 years) (16.2%). The whole coding sequence and pre-miR-17 sequence boundaries were amplified by polymerase chain reaction (PCR). Primers were designed with Primer3 v.0.4.0 (Whitehead Institute for Biomedical Research, Cambridge, UK; Boston, MA, USA) [29 (link)]. Sequencing was performed in an ABI 3730xl automated fluorescence-based sequencer and BigDye v.3.1 terminator system (Applied Biosystems, Foster City, CA, USA).

PCR primers were designed for 13 exons and flanking intronic sequence of TRPC6. Exons of 38 patients with chemotherapy-related CHF (26 from N9831 and 12 from the Mayo Clinic Biobank) were screened for TRPC6 variants by bi-directional sequencing using Big-Dye (v3.1) terminator chemistry and an ABI3730 sequencer according to the manufacturer's instructions (Applied Biosystems). Missense variants identified by Sanger Sequencing were also confirmed by genotyping on the Sequenom platform described below.

Exome analysis was performed as previously described [12 (link)]. Whole-exome sequencing was performed using the HiSeq2500 (Illumina, San Diego, CA, USA) platform, and for the alignment of the sequencing reads the NCBI human genome reference (GRCh37/hg19) was used. Sanger sequencing was performed on genomic DNA prepared from the subject’s fibroblasts and the blood of the parents for validation of prioritized variants. The ABI3130XL and BigDye v3.1 Terminator (Applied Biosystems, Foster City, CA, USA) were used for sanger validation. Sequencing primers were: Chr11_67378517-F: 5′–GCAATGGGCATCTCTGGAGT–3′ and Chr11_67378517-R: 5′–TCTCTTTGTGGACACCTGCC–3′; Chr11_67379443-F: 5′–GCTGGAGGAGGCCAGAAC–3′ and Chr11_67379443-R: 5′–GAAACGTGCCATCACCTTG–3′.