Pspcas9n bb 2a puro px462 crispr cas9 vector

Equal amounts of protein preparations (15–30 μg of total cell lysate, and cytosolic, nuclear, and/or other fractions) were resolved on SDS-PAGE. The antibodies used include: anti-SYK (Abcam, Cambridge, United Kingdom, #ab3113), anti-pCTTN (Y421) (Millipore, #AB3852), anti-cortactin (Cell Signaling Technology, #3503), anti-pSYK (Y525/526) (Cell Signaling Technology, #2710), anti-cofilin (Abcam, #ab11062), anti-GFP (Clontech, #632375), anti-GAPDH (Sigma-Aldrich, St, Louis, MO, USA, #G9545), anti-mouse HRP (Jackson Immuno Research, West Grove, PA, USA, #715-035-150), and anti-rabbit HRP (Jackson Immuno Research, #711-035-152). GAPDH was used as a loading control. The pSpCas9n(BB)-2A-Puro (PX462) CRISPR/Cas9 vector from Addgene (plasmid no. 48141) was used in this study. Cloning was performed using a pair of CRISPR single-guide RNA (sgRNA) specifically targeting exon 2 of SYK; top strand-nicking sgRNA (CGGACAGGGCGAAGCCACCC) and bottom strand-nicking sgRNA (CACACCACTACACCATCGAG) were designed and cloned as previously described.^{49 (link)} OVISE cells were transfected using Lipofectamine^® 3000 (Thermo Fisher Scientific), and positive cells were selected in the presence of 2 μg/ml puromycin. Single cell clones were isolated and screened for Cas9 expression. The SYK knock-out was verified by immunoblotting. Early passage (less than 3) knockout cells were used for experiments.