Phusion high fidelity dna polymerase mix

Illumina fungal rRNA ITS libraries were constructed as follows. PCRs were performed using a DNA Engine thermal cycler (BIO-RAD, Hercules, California) and 100-µl reactions containing: Phusion High-Fidelity DNA Polymerase Mix (New England Biolabs, Ipswich, MA, USA) supplemented with 500 μg/ml BSA, 1 mM MgCl₂, 250 μM of each deoxynucleotide triphosphate (dNTP), 400 nM of each primer, and 4-μl of DNA template. The PCR primers gITS7 (GTGARTCATCGARTCTTTG) and ITS4 (TCCTCCGCTTATTGATATGC) targeted the ITS2 region of the ribosomal rRNA gene operon (Ihrmark et al. 2012 (link); White et al. 1990 (link)), with the reverse primers including 7-base barcodes, and both primers including the Illumina sequences needed for cluster formation. Thermal cycling parameters were 94 °C for 5 min; 35 cycles of 94 °C for 20 s, 56 °C for 20 s, and 72 °C for 30 s; followed by 72 °C for 10 min. PCR products were purified using a QIAquick PCR Purification Kit (Qiagen) according to the manufacturer’s instructions. DNA sequencing (single-end 150 base) was performed using an Illumina MiSeq located at the Genomics Core Facility at the University of California, Riverside.