Plenti cmv neo dest vector

The following constructs were obtained from Addgene: H2B-eGFP (plasmid 11680, from G. Wahl), emerin-eGFP (plasmid 61985, from E. Schirmer), pmRFP-LAP2β-IRES-puro2b (plasmid 21047, from D. Gerlich). The construct encoding eGFP-BAF was made by recombining full-length human BAF into pLenti-CMV-neo-eGFP vector (T. Kuroda, vector plasmid Addgene 17447, from E. Campeau and P. Kaufman). The construct encoding mRFP-H2B was generated by recombining mRFP-H2B into pBABE-Puro vector (T. Kuroda, vector plasmid Addgene 1764, from H. Land, J. Morgenstern and B. Weinberg). The construct encoding TDRFP-NLS (referred to as RFP-NLS throughout the manuscript) was a gift from A. Salic. The construct encoding mNeonGreen-PCNA was made by recombining mNeonGreen-PCNA into pLENTI CMV Neo DEST vector (N. Umbreit, vector plasmid Addgene 17392, from E. Campeau and P. Kaufman) using Gateway LR Clonase II Enzyme (Invitrogen). Before Gateway cloning (Invitrogen), mNeonGreen-PCNA was first amplified by PCR using Ex Taq polymerase (Takara, primers: Forward 5’ CACCATGGTGAGCAAGGG 3’; Reverse 5’ CCTCTACAAATGTGGTATGGCTG 3’) and then the resulting PCR product was inserted into the pCR8/GW/TOPO vector (Invitrogen), according to the manufacturer’s instructions.