Pgl3 promoter vector

Single-stranded oligonucleotides corresponding to 31 nucleotide fragments of the human genome with the variant in the middle including a BamHI and SalI restriction site were purchased (Microsynth). Double-stranded oligonucleotides were generated by mixing equal amounts of complementary oligonucleotides and incubated in a thermocycler for 5 min at 95 °C and then slowly cooled to room temperature (− 1 °C/min). Double-stranded oligonucleotides were cloned downstream from the luciferase gene in the pGL3-promoter vector (Promega). 8 × 10⁴ HT1080 cells were transfected with 1 μg of the pGL3-promoter vector together with 0.1 ng of the pRL-SV40 vector (Promega) using 1.5 μl of Lipofectamine 2000 (Invitrogen). After 18 h, firefly and renilla luciferase activity was measured using the Dual-Glo Luciferase Assay System (Promega). Firefly luciferase activity was corrected for renilla luciferase activity and the data were normalized to cells transfected with the empty pGL3-promoter vector.

Genomic sequences harboring enhancer E_349 (GRCh37/hg19 chr15: 99,982,353–99,983,277), E_155 (GRCh37/hg19 chr10: 89,912,175–89,913,031), E_154 (GRCh37/hg19 chr10: 89,875,711–89,876,693), or E_156 (GRCh37/hg19 chr10: 89,986,509–89,987,396) core region were amplified from the genomic DNA of A375 cells, SK-MEL-28, or SK-MEL-2 cells and separately cloned into the downstream of luciferase gene in the pGL3-Promoter vector (Promega, E1761). After sequencing at the Beijing Genomics Institute (BGI), concentrations of the recombinant plasmids were exactly determined by the Qubit dsDNA HS Assay Kit (ThermoFisher, Q32851). The same copy numbers (equal to 1 µg of the pGL3-Promoter vector) of each recombinant plasmid together with 40 ng of pRL-TK renilla luciferase control vector (Promega, E2241) was transfected into 293T, A375, SK-MEL-28, or SK-MEL-2 cells in 24-well plates using the Lipofectamine 2000 transfection reagent (ThermoFisher, 1168019) following the manufacturer’s description. After 12 h, the transfected cells were lysed and assayed for fluorescence levels before assaying luciferase activity using the Dual-Luciferase Reporter Assay System (Promega, E1960) according to the manufacturer’s protocol. Relative luminescent signals were determined by normalizing firefly luciferase signals with renilla luciferase signals. Primers used are listed in Additional file 15: Table S14.

The miR-22 enhancers were amplified from the whole genome of a Hek-293 cell; enhancer1 and enhancer2 were constructed into a pGL3-Promoter Vector (Promega, E1761). The serial architecture enhancer was constructed by overlap PCR. The AGS and MKN45 cells were transfected with pGL3-Control Vector (Promega, E1741), pGL3-Promoter Vector, pGL3-Promoter Vector-E1, pGL3-Promoter Vector-E2, pGL3-Promoter Vector-E1+E2, and pGL3-Basic Vector (Promega, E1751). After 24 h, the luciferase activity was measured using a microplate system.
A dual-luciferase assay was used to verify the relationship between miR-22 and MeCP2, MTHFD2, and MTHFR. The Hek-293 cells were co-transfected with miR-22 expression vector and pmirGLO–MeCP2, -MTHFD2, and -MTHFR 3′UTR-WT or pmirGLO–MeCP2, -MTHFD2, and -MTHFR 3′UTR-MUT reporter vectors. After 48 h of transfection, the luciferase activity of each group was tested using the Dual-Glo Luciferase Assay kit (Promega) following the manufacturer’s protocol.

Wild-type and mutant PPM1A-reporter vector construction were done using PGL3-promoter vectors (Promega, Madison, USA). The oligonucleotide sequences for luciferase assay were as follows: PPM1A-WT 5’CCAGCCAAUUUUUGUUGUAUGAUU; PPM1A-MUT 5’ CCAGCCAAUUUUUGUUGAUGCCUU, miR-NC or miR-mimics, each at 20 nM, were transfected using either 3’UTR-wt or 3’UTR-mut in TCA8113 and CAL-27 cell lines. The cell luciferase activities were assessed 48 h later with a dual-luciferase reporter system (Promega, Madison, USA).