Abi prism 377 dna sequencer

Manufactured by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom, Malaysia

The ABI PRISM 377 DNA Sequencer is a laboratory instrument used for DNA sequencing. It employs the Sanger sequencing method to determine the order of nucleotides in DNA samples. The core function of the ABI PRISM 377 is to generate DNA sequence data.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

ABI Prism 377 (66 citations) ABI 377 (29 citations) ABI 377 DNA sequencer (15 citations) ABI 377 sequencer (10 citations) ABI Prism 377 sequencer (7 citations) ABI Prism 377 automated DNA sequencer (7 citations) ABI Prism DNA sequencer (5 citations) 377 DNA sequencer (5 citations) ABI PRISM 377‐96 DNA Sequencer (5 citations) ABI PRISM 377 automatic DNA sequencer (5 citations)

75 protocols using abi prism 377 dna sequencer

Microsatellite and OPA1 Gene Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was extracted from blood by a standard salting out method. For amplification of microsatellite markers (D3S3642, D3S3590, D3S2305, D3S3562, D3S2748) PCR primer sequences were retrieved from the Ensembl Genome Browser (http://www.ensembl.org). Forward primers were 5’labeled with 6-carboxyfluorescein (6-FAM) and reverse primers were unlabeled. PCR products were mixed with a fluorescent size marker (Applied Biosystems, Foster City, CA, USA) and analyzed on ABI PRISM 377 DNA sequencer (Applied Biosystems). Fragment lengths were analyzed with the Gene Mapper software (Applied Biosystems).
For the amplification of all OPA1 exons PCR primers were designed with the Primer 3 Plus public domain software (http://primer3plus.com/cgi-bin/dev/primer3plus.cgi) and the OPA1 gene NG_011605.1 reference sequence. The OPA1 exon amplicons were sequenced using the BigDye Termination cycle sequencing kit v3.1 (Applied Biosystems) and analyzed on ABI PRISM 377 DNA sequencer (Applied Biosystems). The results were visualized by the Variant Reporter Software v1.1 (Applied Biosystems). PCR primers and reaction conditions are available upon request.

Ścieżyńska A., Ruszkowska E., Szulborski K., Rydz K., Wierzbowska J., Kosińska J., Rękas M., Płoski R., Szaflik J.P, & Ołdak M. (2017). Processing of OPA1 with a novel N-terminal mutation in patients with autosomal dominant optic atrophy: Escape from nonsense-mediated decay. PLoS ONE, 12(8), e0183866.

+ Open protocol

+ Expand

Plasmid Isolation and Confirmation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Recombinant clones were selected for plasmid isolation as per the manufacturer’s protocol using the GenElute HP Plasmid Miniprep Kit (Sigma). Isolated plasmids were analyzed on 0.8% agarose gel. PCR using vector-specific and gene specific primers was done to confirm the presence of insert. The recombinant plasmids were sequenced in ABI Prism 377 DNA sequencer (Applied Biosystem) at SciGenom, India.

Athira P.P., Anooja V.V., Anju M.V., Neelima S., Archana K., Muhammed Musthafa S., Antony S.P., Bright Singh I.S, & Philip R. (2022). A hepatic antimicrobial peptide, hepcidin from Indian major carp, Catla catla: molecular identification and functional characterization. Journal of Genetic Engineering & Biotechnology, 20, 49.

+ Open protocol

+ Expand

Genetic Profiling of Psychiatric Disorders

Check if the same lab product or an alternative is used in the 5 most similar protocols

According to the previous studies [11 (link)–23 (link)], the SNPs which were found to be related to the development of psychiatric disorders were selected from the 1000 genome database of Han Chinese in Beijing, China (CHB) (http://www.internationalgenome.org/). We focused on eight SNPs in the OXTR gene, including rs1042778, rs13316193, rs2254298, rs2268494, rs237889, rs237897, rs53576, rs6770632.
Venous blood samples were collected from 765 subjects (342 subjects in BP group and 423 subjects in non-BP group). Genetic DNA was extracted using Sunshinebio TM blood genomic DNA Extraction Kit (Sunshinebio, Nanjing, China) following the manufacturer’s instructions. The extracted DNA was diluted to a concentration of 50 ng/μL. Genotyping of the OXTR SNPs applied multiple PCR technology and high-throughput sequencing technology. The primers showed in Additional file 1: Table S1. Multiple PCR amplification was performed using PERKIN ELMER Gene Amp PCR system 9600 (Applied Biosystems, Shanghai, China). Different samples were distinguished by different Barcode primers, and the high flux sequencing of the amplified products was performed using ABI PRISM 377 DNA Sequencer (Applied Biosystem, Shanghai, China). Several samples failed to be genotyped, but the call rates for all SNPs almost reached 95% (Table 2).

Zhang M., Liu N., Chen H, & Zhang N. (2020). Oxytocin receptor gene, childhood maltreatment and borderline personality disorder features among male inmates in China. BMC Psychiatry, 20, 332.

+ Open protocol

+ Expand

UBIAD1 Gene Variant Screening Protocol

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was isolated from blood samples (n = 37) with a standard salting-out procedure. DNA pathogenic variant testing was performed by PCR amplifying and Sanger sequencing of the UBIAD1 gene coding regions (exons 1 and 2). The PCR primer sequences designed using the reference sequence NG_009443.1 and amplification conditions are available upon request. DNA samples were purified with exonuclease I and FastAP thermosensitive alkaline phosphatase (Thermo Fisher Scientific, Waltham, Massachusetts, USA) according to the manufacturer’s protocol, sequenced directly using ABI Prism 377 DNA Sequencer (Thermo Fisher Scientific) and BigDye Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific) and analyzed with the Variant Reporter DNA analysis software v1.1 (Thermo Fisher Scientific).
Pathogenicity of the novel non-synonymous single nucleotide UBIAD1 variant was predicted using PredictSNP2 [15 (link)], FATHMM [16 (link)], and MutPred2 [17 ], leading and reliable computational approaches [18 (link)] and analyzed for population frequency based on the data from Exome Aggregation Consortium (ExAC, http://exac.broadinstitute.org), 1000 Genomes Project (http://www.1000genomes.org), and NHLBI GO Exome Sequencing Project (ESP, http://evs.gs.washington.edu/EVS; all accessed 06/2018).

Sarosiak A., Udziela M., Ścieżyńska A., Oziębło D., Wawrzynowska A., Szaflik J.P, & Ołdak M. (2018). Clinical diversity in patients with Schnyder corneal dystrophy—a novel and known UBIAD1 pathogenic variants. Graefe's Archive for Clinical and Experimental Ophthalmology, 256(11), 2127-2134.

+ Open protocol

+ Expand

Closing Gaps in Abalone Genome Assemblies

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR primers (Supplemental Table 2) were manually designed to close gaps between 12 scaffolds, which had been selected by the survey described above. PCR was performed using the KOD FX kit with a pooled DNA sample of diseased abalone obtained from Omaezaki. Amplification was as described above, except that the extension step was elongated to 10 min. PCR products were analyzed using agarose gel electrophoresis, and DNA from positive reactions were purified using the Wizard SV Gel and PCR Clean-Up System (Promega). Direct sequencing was performed using the ABI PRISM BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and the ABI PRISM 377 DNA sequencer (Thermo Fisher Scientific).

Matsuyama T., Takano T., Nishiki I., Fujiwara A., Kiryu I., Inada M., Sakai T., Terashima S., Matsuura Y., Isowa K, & Nakayasu C. (2020). A novel Asfarvirus-like virus identified as a potential cause of mass mortality of abalone. Scientific Reports, 10, 4620.

+ Open protocol

+ Expand

LAMP Reaction Evaluation and Verification

Check if the same lab product or an alternative is used in the 5 most similar protocols

The LAMP reaction was evaluated by visual inspection based on its generation of turbidity proportional to the amount of amplified DNA [21 (link)]. For further confirmation, a Loopamp real-time turbidimeter (LA-200 real-time turbidimeter; Eiken Chemical Co., Ltd., Tokyo, Japan) was used to monitor the turbidity in the reaction tube in real-time by reading the OD₆₅₀ every 6 s. We used the application software for the turbidimeter to obtain the amplification time required to exceed a turbidity level of 0.1 (Tt), according to the manufacturer’s protocol [21 (link)]. For the detection limit study, a colorimetric visual inspection dye (Kaneka, Co., Ltd., Osaka, Japan) dried down in the caps of the reaction tubes was used [22 (link)]. After the reactions, the LAMP amplicons were mixed with the dye by inverting the tubes and the color changes were observed.
To verify their structure, the amplified LAMP products were sequenced using a BigDye Terminator v. 3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA) and an ABI PRISM 377 DNA sequencer (Applied Biosystems) according to the manufacturer’s instructions. The target region was between F2 and B2, and the primer sequences were from the F2 and B2 regions (Fig 1).

Lee D., Kim E.J., Kilgore P.E., Kim S.A., Takahashi H., Ohnishi M., Anh D.D., Dong B.Q., Kim J.S., Tomono J., Miyamoto S., Notomi T., Kim D.W, & Seki M. (2015). Clinical Evaluation of a Loop-Mediated Isothermal Amplification (LAMP) Assay for Rapid Detection of Neisseria meningitidis in Cerebrospinal Fluid. PLoS ONE, 10(4), e0122922.

+ Open protocol

+ Expand

Sequencing Rac1 and Rac1b in Melanoma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR primers (Rac1AS: TTACAACAGCAGGCATTTTC, Rac1SE: ATGCAGGCCATCAAGTGTGT) were designed for amplification of full coding region (CDS) of Rac1 and Rac1b variant (GID 5879), and used to amplify cDNA of each melanoma cell line. The amplicon were DNA sequenced using Big dye terminator kit v3 in ABI PRISM 377 DNA Sequencer (Applied Biosystems, Foster City, CA, USA) and compared to GenBank deposited sequence of human Rac1 gene (GID: 5879).

Salvatierra E., Alvarez M.J., Leishman C.C., Rivas Baquero E., Lutzky V.P., Chuluyan H.E, & Podhajcer O.L. (2015). SPARC Controls Melanoma Cell Plasticity through Rac1. PLoS ONE, 10(8), e0134714.

+ Open protocol

+ Expand

SNP Genotyping via PCR and Sanger Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was isolated from the whole blood samples using the QIAGEN QIAamp Blood Mini Kit (Catalogue No. 51104) per the manufacturer’s instruction and stored at -20°C until further analysis. To detect single nucleotide polymorphism [SNPs], genotyping was carried out by Polymerase Chain reaction (PCR) followed by direct Sanger Dye Deoxy sequencing. PCR amplification was conductedin a 30 μl volume containing 50–100 ng of DNA, 1 μl of each primer (10 mmol/L), 0.2 μl of deoxyribonucleotide triphosphate mix (dNTPs, 10mmol/L; Invitrogen Carlsbad, CA, USA), 1.5 μl magnesium chloride (MgCl2, 50 mmol/L), 1X PCR reaction buffer and 0.8 μl of Taq Polymerase (5 units/lμl; Invitrogen, California, USA). PCR products were directly sequenced using a Taq Dye Deoxy Terminator sequencing kit (Applied Biosystems, Foster City, USA) with an ABI Prism 377 DNA Sequencer (Applied Biosystems, Foster City, USA). The electropherogram and DNA base sequence was viewed using the program Snap-Gene Viewer (version 5.0.7).

Pal U., Halder P., Ray A., Sarkar S., Datta S., Ghosh P, & Ghosh S. (2021). The etiology of Down syndrome: Maternal MCM9 polymorphisms increase risk of reduced recombination and nondisjunction of chromosome 21 during meiosis I within oocyte. PLoS Genetics, 17(3), e1009462.

+ Open protocol

+ Expand

Molecular Sequence Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

The full-length amplification products were eluted from the gel using the Concert™ Rapid Gel kit (Gibco BRL™, Rochville, MD, USA), before being precipitated and resuspended in sterile water following the manufacturer’s instructions. The purified DNA products were subjected to direct sequencing according to the chain termination method [55 (link)] using the BigDye kit (Applied Biosystems, Foster City, CA, USA) and were sequenced in an ABI PRISM 377 DNA Sequencer (Applied Biosystems, Foster City, CA, USA) following the manufacturer’s instructions. Comparisons with other sequences in databases were made with the Basic Local Alignment Search Tool, BLASTn program (National Center for Biotechnology Information, NCBI), available on the world wide web. Multiple alignments were conducted using the BioEdit 7.2.0. software (Carlsbad, CA, USA), and the RNA secondary structures were predicted with the Mfold program for circular molecules [56 (link)]. Phylogenetic trees were constructed by neighbor joining (NJ) using the MEGA 7.0 software. Tree branches were tested by bootstrap with 1500 replications.

Gobatto D., de Oliveira L.A., de Siqueira Franco D.A., Velásquez N., Daròs J.A, & Eiras M. (2019). Surveys in the Chrysanthemum Production Areas of Brazil and Colombia Reveal That Weeds Are Potential Reservoirs of Chrysanthemum Stunt Viroid. Viruses, 11(4), 355.

+ Open protocol

+ Expand

Genetic Profiling of Monogenic Hypertension

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

All participants provided venous blood samples for genetic testing. Genomic DNA was extracted from peripheral blood leucocytes using the QIAamp DNA Blood Mini kit (QIAGEN, Hilden, Germany) by standard protocols. Next-generation sequencing of 41 monogenic hypertension-related genes was performed for the proband (Supplementary Table 1). All coding exons were enriched using custom-made SureSelect Target Enrichment System (Agilent Technologies, Inc., Santa Clara, CA). Captured DNA library were sequenced on Illumina Hiseq X Ten according to standard protocol for paired-end 150bp reads. Paired-end reads were aligned to the reference genome (hg19) using the Burrows–Wheeler Aligner and duplicated reads were marked by Picard.^{12 (link)} SNVs and indels were detected by SAMtools, and Annovar^{13 (link)} was used for annotation. A mutation in γ-ENaC was identified by polymerase chain reaction (PCR) using gene-specific primer pairs: SCNN1G: (GenBank accession number NM_001039): forward primer: 5′-CTTGGGAATCAGGGTTCCTGTG-3′, reverse primer: 5′-AAGCAGGCTTTTTGGTCAGAGT-3′.^{14 (link)} The PCR products were sequenced bidirectionally using an ABI Prism 377 DNA sequencer (Applied Biosystems, Foster City, CA).

Fan P., Zhao Y.M., Zhang D., Liao Y., Yang K.Q., Tian T., Lou Y., Luo F., Ma W.J., Zhang H.M., Song L., Cai J., Liu Y.X, & Zhou X.L. (2019). A Novel Frameshift Mutation of SCNN1G Causing Liddle Syndrome with Normokalemia. American Journal of Hypertension, 32(8), 752-758.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!