Maxima cdna synthesis kit

Total RNA was extracted using the Spectrum Plant Total RNA Kit (Sigma‐Aldrich) and reverse‐transcribed with the Maxima cDNA Synthesis Kit (Thermo Scientific). RT‐qPCR was performed with a StepOne Real‐Time PCR System (Applied Biosystems) using Fast SYBR Green Master Mix (Applied Biosystems) and gene‐specific primers. The expression data were analysed by ΔΔC_t (Livak and Schmittgen, 2001). For each sample, three independent biological replicates were used.
Expression level of LE in the wild type and the three independent transgenic lines was measured following induction of LE expression by wounding of detached leaves, as described previously (Lers et al., 1998), followed by RT‐qPCR analysis. Primer pair P5 (LE forward 5′‐ACCAGTCGGGTAACAGTCAG‐3′ and LE reverse 5′‐GCTTGTGCCACATTTCCCTC‐3′) was used for LE expression analysis. Actin gene expression served as the internal expression control, reported previously (Vossen et al., 2010). For measuring the expression of defence‐related genes following fungal leaf infection, tissue outside the necrotic lesion area was used and gene expression was measured by RT‐qPCR analyses using primer pairs as indicated in Table S1.

All reverse transcription (RT) experiments were performed in accordance with the minimum information for publication of digital quantitative PCR experiments (dMIQE) guidelines (see Table S2 in the supplemental material) (27 (link)). The Maxima cDNA synthesis kit (Thermo Scientific) was used according to the manufacturer's instructions with the addition of 200 nM H275Y reverse primer to each 20-μl reaction mixture. For all experiments, triplicate RT reactions were performed with a single dPCR analysis per RT reaction. To monitor DNA contamination, reaction mixtures containing 1 × 10⁵ IVT RNA copies per reaction volume with the reverse transcriptase omitted were performed; in all cases no amplification occurred (see Fig. S2F in the supplemental material). No-template controls (NTCs) were performed using carrier in place of template in every experiment; in all cases no DNA was detected (see Fig. S2A). RT was performed with an initial incubation at 25°C for 10 min, followed by RT at 50°C for 15 min. The enzyme was inactivated at 85°C for 5 min. The cDNA was either stored at −80°C or immediately analyzed by dPCR.

Liver RNA was extracted using the RNeasy Plus Universal Mini Kit (Qiagen, Cat. 73404). Reverse transcription was performed using the Maxima cDNA Synthesis Kit (Thermo Fisher Scientific, Cat. K1681). Generated cDNA was amplified using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad, Cat. 172–5271) in a Bio-Rad CFX RT-PCR detection system. The final volume of RT-qPCR reaction mix was 20 µL that contains 25 ng of cDNA (5 µL), 450 nM of the forward and reverse primers (1.8 µL), 1X SYBR Green (10 µL), and water (3.2 µL). We randomly selected WT (n=5) and E4 (n=4) mice as biological replicates for RT-qPCR analysis. Duplicates (n=2 technical replicates) were run for all the samples and average Ct values were calculated. The relative mRNA expression was determined using the 2ˆ(−ΔΔCt) method while the Tbp1 or beta-2 microglobulin (B2m) gene was used as a reference gene. Gene primer list and sequences are as described previously.17 (link)