Intesticult organoid growth medium

Manufactured by STEMCELL

Sourced in Canada, United States

IntestiCult Organoid Growth Medium is a serum-free, animal component-free culture medium designed to support the growth and expansion of intestinal organoids derived from primary intestinal epithelial cells or induced pluripotent stem cells.

Automatically generated - may contain errors

Lab products found in correlation

Matrigel, by Corning (35 mentions) Gentle cell dissociation reagent (gcdr), by STEMCELL (20 mentions) Matrigel, by STEMCELL (9 mentions) Matrigel matrix, by Corning (8 mentions) Intesticult organoid growth medium, by Corning (5 mentions) Matrigel, by BD (4 mentions) Glutamax, by Thermo Fisher Scientific (4 mentions) Tryple express, by Thermo Fisher Scientific (4 mentions) Primocin, by STEMCELL (3 mentions) Primocin, by InvivoGen (3 mentions) Advanced dmem f12, by Thermo Fisher Scientific (3 mentions) Ca2 mg2, by Corning (2 mentions) Antibiotic antimycotic, by Thermo Fisher Scientific (2 mentions) Bovine serum albumin (bsa), by Gemini Bio (2 mentions) Bay 60 6583, by Bio-Techne (2 mentions) Matrigel membrane matrix growth factor reduced, by Corning (2 mentions) Dmem f12, by STEMCELL (2 mentions) Epidermal growth factor (egf), by Thermo Fisher Scientific (2 mentions) N acetylcysteine, by Merck Group (2 mentions) Wnt3a, by Thermo Fisher Scientific (2 mentions)

95 protocols using intesticult organoid growth medium

Isolation and Culture of Intestinal Organoids

Check if the same lab product or an alternative is used in the 5 most similar protocols

Small intestines of 7–10 weeks old Cd44^fl/fl;VillinCreER^T2 mice were washed with PBS and opened longitudinally. Intestines were placed villi facing up. Villi were gently removed using a glass slide and the intestines were washed in PBS until no cell debris remained. The washed intestines were incubated with 2 mM EDTA for 30 min at 4 °C. Crypts were mechanically released from the surrounding tissue by shaking. The freed crypts were pelleted and passed through a 70 μm strainer. Isolated crypts were resuspended in Matrigel (Corning) and cultured in 500 μl complete IntestiCult™ Organoid Growth Medium (STEMCELL Technologies) based on the previously described standard ENR medium (Adv. DMEM F12 (Sigma), 50 ng/ml EGF (Peprotech), 100 ng/ml Noggin (Peprotech), 3 µm CHIR99021 (CHIR) (Selleckchem), B27 (Gibco), N2 (Gibco), 1 mM N-Acetyl cysteine (Sigma)) [16 (link)] in 24-well plates. 4-hydroxytamoxifen (4-OHT) (1 mM) (Sigma) or ethanol was added for 48 hours. Organoids were split by a mechanical breakup and dispersed crypts were reseeded every fifth day in a 1:2 ratio for 2 passages. Organoids were treated with CHIR (15 µM) or DMSO in IntestiCult™ Organoid Growth Medium (STEMCELL Technologies) or in ENR supplemented with 50% Wnt3a CM and 20% R-Spondin CM or 5% R-Spondin CM only.

Walter R.J., Sonnentag S.J., Munoz-Sagredo L., Merkel M., Richert L., Bunert F., Heneka Y.M., Loustau T., Hodder M., Ridgway R.A., Sansom O.J., Mely Y., Rothbauer U., Schmitt M, & Orian-Rousseau V. (2022). Wnt signaling is boosted during intestinal regeneration by a CD44-positive feedback loop. Cell Death & Disease, 13(2), 168.

+ Open protocol

+ Expand

Murine Intestinal Organoid Culture

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Organoids were cultured from crypt-enriched jejunal and ileal fractions from 6- to 12-week-old Mx2tRFP mice as previously described (22 (link)). Briefly, a 10 cm midsection of the small intestine was excised and flushed with ice cold PBS. After removal of mucus and villi, the intestine was cut into 1–2 cm pieces and washed extensively with cold PBS. The epithelium was dissociated for 30 min at 4°C in a solution of 2 mM EDTA in PBS. Afterward, the crypts were suspended in 10% FCS in PBS and passed through a 70-mm cell strainer (BD Biosciences), centrifuged at 200 g (5 min, 4°C), and resuspended in 10 ml Ad-DF medium [advanced DMEM/F12 supplemented with 1% Glutamax (Invitrogen), 10 mM HEPES, and 100 U/ml of Penicillin/Streptomycin]. After centrifugation, the crypts were resuspended in Matrigel (BD Biosciences) at a desired crypt density. 20 µl Matrigel was seeded per well on a pre-warmed 48-well flat-bottom plate and incubated for 30 min at 37°C and 5% CO₂ atmosphere. Then, 300 µl of Intesticult organoid growth medium (Stemcell Technologies) was added. The passaging was performed every 1–2 weeks with a split ratio of 1:3 by harvesting the organoids, mechanic disruption into single crypt domains, and seeding with fresh Matrigel.

Bhushal S., Wolfsmüller M., Selvakumar T.A., Kemper L., Wirth D., Hornef M.W., Hauser H, & Köster M. (2017). Cell Polarization and Epigenetic Status Shape the Heterogeneous Response to Type III Interferons in Intestinal Epithelial Cells. Frontiers in Immunology, 8, 671.

+ Open protocol

+ Expand

Porcine Intestinal Epithelial Cell Culture

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Crypt cells were extracted from the small intestine (ileum) as described previously [24 (link)], with slight modifications detailed in Guo et al. [7 (link)]. The culture conditions for porcine IEs’ (PIEs’) maintenance and differentiation were formulated as follows: complete medium without growth factors (CMGF(-) medium) consisted of advanced DMEM/F12 medium (Invitrogen, US) supplemented with 100 U/mL penicillin–streptomycin (PS, Invitrogen), 10 mM HEPES buffer (Invitrogen), and 1% of GlutaMAX-100x (Invitrogen) [24 (link),28 (link)]. The complete cell culture medium contained IntestiCult Organoid Growth Medium (Component A: Component B ratio = 1:1) (STEMCELL), 100 U/mL of PS (Invitrogen), and 2.5 µM of CHIR99021 (Stemgent). The differentiation medium (DM) contained IntestiCult Organoid Growth Medium Components A and B added at a ratio of 1:0.8, supplemented with 100 U/mL of PS (Invitrogen).

Guo Y., Raev S., Kick M.K., Raque M., Saif L.J, & Vlasova A.N. (2022). Rotavirus C Replication in Porcine Intestinal Enteroids Reveals Roles for Cellular Cholesterol and Sialic Acids. Viruses, 14(8), 1825.

+ Open protocol

+ Expand

Generation of Intestinal Organoids from Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

Enteroids from wild-type and Prap1^-/- littermates were generated using the IntestiCult Organoid Growth Medium (mouse) from StemCell Technologies (Vancouver, Canada) following the manufacturer’s provided protocol. Briefly, the entire length of the small intestine was dissected, washed, and digested for the collection of small intestinal crypts. The crypts were enumerated and combined with a 1:1 ratio of IntestiCult Organoid Growth Medium and Matrigel (Corning, Tewksbury, MA). Media was refreshed every 2 days and enteroids were passaged every 7 days. For irradiation experiments, enteroids were irradiated on days 4–5 of culture.

Wolfarth A.A., Liu X., Darby T.M., Boyer D.J., Spizman J.B., Owens J.A., Chandrasekharan B., Naudin C.R., Hanley K.Z., Robinson B.S., Ortlund E.A., Jones R.M, & Neish A.S. (2020). Proline-Rich Acidic Protein 1 (PRAP1) Protects the Gastrointestinal Epithelium From Irradiation-Induced Apoptosis. Cellular and Molecular Gastroenterology and Hepatology, 10(4), 713-727.

+ Open protocol

+ Expand

Modeling Intestinal Fibrosis in IBD

Check if the same lab product or an alternative is used in the 5 most similar protocols

To model intestinal fibrosis as a complication of IBD, human intestinal stem cells were mixed with 1 × 10⁶ cells per ml of primary human intestinal fibroblasts in Matrigel (356255, Corning). This cell-containing hydrogel solution was injected into the device to form microtissue constructs in the organoid culture chambers. After gelation for 15 min in a regular cell culture incubator, 750 μl of IntestiCult organoid growth medium (06010, STEMCELL Technologies) was added into each well and maintained for 14 d to induce intestinal organoid development and fibroblast proliferation. During this period, the media were replenished every other day.

Sutton A.J., Duval S.J., Tweedie R.L., Abrams K.R, & Jones D.R. (2000). Empirical assessment of effect of publication bias on meta-analyses. BMJ : British Medical Journal, 320(7249), 1574-1577.

+ Open protocol

+ Expand

Isolation and Culture of Intestinal Organoids

Check if the same lab product or an alternative is used in the 5 most similar protocols

Intestines were washed in ice-cold PBS (Mg^2+/Ca²⁺) (Corning, cat # 21–031-CM), containing 2% BSA (Gemini Bio-products, cat #900–208) and 2% antibiotic-antimycotic (Gibco, cat #15240–062). Crypts and villi were exposed by dicing the intestines into small pieces (1–2 cm long), followed by extensive washes to remove contaminants (Sato and Clevers, 2013 (link)). Then, GCDR (Gentle Cell Dissociation Reagent, Stem cell technologies, cat #7174) was used according to the manufacturer’s instructions. Briefly, intestinal pieces were incubated on a gently rotating platform for 15 minutes. Subsequently, GCDR was removed and intestinal pieces were washed 3 times with PBS wash buffer with vigorous pipetting. The first and second fractions that usually contain loose pieces of mesenchyme and villi were not used. Fractions three and four containing the intestinal crypts were collected and pooled. Isolated crypts were filtered through a 70μm nylon cell strainer (Falcon, cat #352350). Crypts were counted, then embedded in Matrigel (Corning, growth factor reduced, cat #354230), and cultured in Intesticult organoid growth medium (Stem cell technologies, cat #6005). For mouse colon organoids, additional Wnt3a (300ng/μl, R&D, cat #5036-WN-010) was added. Intestinal organoids used in this study were generated from APC^min/+ mice, Lgr5-GFP mice, Lgr5-GFP/APC^flox mice, Lgr5-GFP/FXR^flox mice, FXRKO mice.

Fu T., Coulter S., Yoshihara E., Oh T.G., Fang S., Cayabyab F., Zhu Q., Zhang T., Leblanc M., Liu S., He M., Waizenegger W., Gasser E., Schnabl B., Atkins A.R., Yu R.T., Knight R., Liddle C., Downes M, & Evans R.M. (2019). FXR regulates intestinal cancer stem cell proliferation. Cell, 176(5), 1098-1112.e18.

+ Open protocol

+ Expand

Goblet Cell Differentiation in Intestinal Organoids

Check if the same lab product or an alternative is used in the 5 most similar protocols

The mice aged 6–10 wk were used to generate intestinal organoids as previously reported (Sato et al., 2009 (link)). Briefly, the small intestine was isolated and washed with cold PBS, and crypts were isolated following dissociation in EDTA. Isolated crypts were suspended in Matrigel. Following polymerization, IntestiCult Organoid Growth Medium (STEMCELL Technologies) was added and refreshed every 3–4 d. Organoids were maintained at 37°C and 5% CO₂ and propagated weekly.
For the induction of goblet cell–enriched differentiation, organoids were cultured in standard culture conditions and plated in Matrigel for 2 d. The organoids were then differentiated with the addition of IWP2 (N-[6-methyl-2-benzothiazolyl]-2-[(3,4,6,7-tetrahydro-4-oxo-3-phenylthieno[3,2-d]pyrimidin-2-yl)thio]-acetamide; 1.5 mM; Sigma-Aldrich) and DAPT (N-[N-(3,5-difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester; 10 mM; Sigma-Aldrich) for 7 d. The organoid cells were released from Matrigel and fixed for immunofluorescence staining.

Chen Z., Luo J., Li J., Kim G., Chen E.S., Xiao S., Snapper S.B., Bao B., An D., Blumberg R.S., Lin C.H., Wang S., Zhong J., Liu K., Li Q., Wu C, & Kuchroo V.K. (2021). Foxo1 controls gut homeostasis and commensalism by regulating mucus secretion. The Journal of Experimental Medicine, 218(9), e20210324.

+ Open protocol

+ Expand

Mouse and Human Intestinal Organoids

Check if the same lab product or an alternative is used in the 5 most similar protocols

For mouse small intestinal organoids, crypts were isolated using EDTA chelation from the duodenum and cultured as described (49 (link)).For human small intestinal organoids, crypts were isolated using EDTA chelation from the duodenum as previously described (50 (link)). IntestiCult Organoid Growth Medium (human) or IntestiCult Organoid Differentiation Medium (human) were used for culture or differentiation of hGOs (STEMCELL Technologies). Organoids were used prior to passage 3 for optimal efficiency of EEC and β-like cell induction.

Du W., Wang J., Kuo T., Wang L., McKimpson W.M., Son J., Watanabe H., Kitamoto T., Lee Y., Creusot R.J., Ratner L.E., McCune K., Chen Y.W., Grubbs B.H., Thornton M.E., Fan J., Sultana N., Diaz B.S., Balasubramanian I., Gao N., Belvedere S, & Accili D. (2022). Pharmacological conversion of gut epithelial cells into insulin-producing cells lowers glycemia in diabetic animals. The Journal of Clinical Investigation, 132(24), e162720.

+ Open protocol

+ Expand

Zymosan-A Induced Intestinal Organoid Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Zymosan-A was purchased from Sigma Aldrich Corp (St. Louis, MO, USA), WR2721 and normal saline (NS) was obtained from ChangHai Hospital (Shanghai, China). The PCR kit (RR036A and RR420A) was purchased from TAKARA (Japan). PBS, RPMI 1640, DMEM, and fetal bovine serum (FBS) were supplied by Gibco (New York, USA). IntestiCult™ Organoid Growth Medium was obtained from STEM CELL (Canada). The antibodies for Western blot (GAPDH, YAP1, WNT5A, WNT3A, MYD88, TLR2, OLFM4, ASCL2, CYCLIND1, AXIN2) were purchased from Cell Signaling Technology (Massachusetts, USA). The antibody for western blot (ASCL2) was purchased from Biorbyt (Cambridge, United Kingdom). In Situ Cell Death Detection Kit was obtained from Roche (Basel, Switzerland). Small molecule Foscenvivint (ICG-001) was purchased from Selleck. The primes were obtained from Shenggong Biotech (Shanghai, China).

LGR5- Forward Primer	CCTACTCGAAGACTTACCCAGT
LGR5- Reverse Primer	GCATTGGGGTGAATGATAGCA
ASCL2- Forward Primer	AAGCACACCTTGACTGGTACG
ASCL2- Reverse Primer	AAGTGGACGTTTGCACCTTCA

Du J., Fang L., Zhao J., Yu Y., Feng Z., Wang Y., Cheng Y., Li B., Gao F, & Liu C. (2022). Zymosan-A promotes the regeneration of intestinal stem cells by upregulating ASCL2. Cell Death & Disease, 13(10), 884.

+ Open protocol

+ Expand

Isolation and Culture of Murine Intestinal Crypts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Proximal small intestines of Villin^Cre mice were flushed with ice-cold PBS. Tissue was incubated in 10mL of crypt isolation buffer (1xPBS-2mM EDTA) on a rocker for 5 min at 4°C. Tissue was cut longitudinally into small fragments roughly 0.8cm long and incubated in fresh isolation buffer on a rocker for 45 min at 4°C. After incubation, tubes were shaken vigorously until tissue floated, indicating removal of the mucosal layer. Cell suspensions were passed through 70μm cell strainer. Cells were washed with 1 × DMEM and then centrifuged at 50 × g for 10 min. Crypts were counted by hemocytometer and plated at 350 crypts per well in a 1:1 ratio of Matrigel™ Membrane Matrix Growth Factor Reduced (Corning, Cat #354230) to Advanced DMEM/F-12 (Thermo Scientific, catalog #12634-010). Enteroids were cultured for five days in IntestiCult™ Organoid Growth Medium (StemCell Technologies, Vancouver, Canada, catalog # 06005). Wells were treated with 10 μm of BAY 60–6583 (Tocris Bioscience, Bristol, UK, catalog# 4472) or vehicle control (DMSO) for 48 h. Organoids were harvested and lysed in RIPA buffer with 2× protease inhibitors and 2× EDTA (Thermo Scientific, catalog# 78444). Cell lysate protein concentration was determined using Bradford protein assay kit as explained above.

El-Naccache D.W., Chen F., Palma M.J., Lemenze A., Fischer M.A., Wu W., Mishra P.K., Eltzschig H.K., Robson S.C., Di Virgilio F., Yap G.S., Edelblum K.L., Haskó G, & Gause W.C. (2022). Adenosine metabolized from extracellular ATP promotes type 2 immunity through triggering A2BAR signaling in intestinal epithelial cells. Cell reports, 40(5), 111150.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!