Multi-walled carbon nanotubes (MWCNTs) (outer diameter: 6–13 nm, length: 2.5–20 μm, purity >98%), bovine serum albumin (BSA), and hydroquinone (HQ) were purchased from Sigma-Aldrich. Ethanol and sodium chloride (NaCl) were obtained from J.T. Baker and Mallinckrodt, respectively. Potassium ferrocyanide (K4Fe(CN)6) and potassium ferricyanide (K3Fe(CN)6) were acquired from Merck. Polysorbate 20 (Tween 20) were purchased from Parafarm. Hydrogen peroxide (30% v/v aqueous solution) was obtained from Cicarelli. Avidin (Av) from egg white (catalog number A-2667), streptavidin (Strep) (catalog number 434302), and biotinylated horseradish peroxidase (bHRP) (catalog number 432040) were supplied by Invitrogen. DNA sequences, purchased from GenScript company, are as follows:
Potassium ferrocyanide k4 fe cn 6
Manufactured by Merck Group
Sourced in Germany, United States, United Kingdom, Canada
Potassium ferrocyanide (K4[Fe(CN)6]) is a yellow crystalline compound that is widely used in various laboratory and industrial applications. It is a soluble salt of ferrocyanic acid, with the chemical formula K4[Fe(CN)6]. Potassium ferrocyanide is a stable, non-flammable, and non-toxic compound that is commonly used as a reagent and analytical tool in various scientific and technical fields.
Automatically generated - may contain errors
Lab products found in correlation
Potassium ferricyanide k3 fe cn 6, by Merck Group (16 mentions)
Potassium chloride (kcl), by Merck Group (9 mentions)
Bovine serum albumin (bsa), by Merck Group (5 mentions)
Hydrochloric acid (hcl), by Merck Group (4 mentions)
Ascorbic acid, by Merck Group (3 mentions)
Ethanol, by Merck Group (3 mentions)
8 hydroxy 2 deoxyguanosine 8 ohdg, by Cayman Chemical (2 mentions)
Glacial acetic acid, by Merck Group (2 mentions)
Uric acid, by Merck Group (2 mentions)
Sodium chloride (nacl), by Merck Group (2 mentions)
Hydroquinone, by Merck Group (1 mentions)
Multi walled carbon nanotubes mwcnt, by Merck Group (1 mentions)
Potassium chloride (kcl), by Avantor (1 mentions)
Sodium dihydrogen phosphate, by Avantor (1 mentions)
Di sodium hydrogen phosphate anhydrous, by Avantor (1 mentions)
Mquant nitrite test, by Merck Group (1 mentions)
Urea, by Thermo Fisher Scientific (1 mentions)
N n dimethylformamide (dmf), by Merck Group (1 mentions)
Dimethylformamide dmf, by Avantor (1 mentions)
D glucose anhydrous, by HiMedia (1 mentions)
27 protocols using potassium ferrocyanide k4 fe cn 6
1
Functionalized carbon nanotube-based biosensing
2
Analytical Grade Chemicals for Research
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The chemicals used during the experiments were of analytical grade and were not further purified before usage. Graphite rods (6 mm diameter, 99.995% purity); potassium chloride (KCl, 99.98%); sodium dihydrogen phosphate (NaH2PO4, 100%) and di-sodium hydrogen phosphate anhydrous (Na2HPO4, 99.7%) were supplied by VWR Chemicals (Leuven, Belgium). Sodium acetate anhydrous (CH3COONa, ≥99.0%); ammonium sulphate ((NH4)2SO4, ≥99.0%), sodium chloride (NaCl, 99.5%); sodium carbonate anhydrous (Na2CO3, 99.3%), magnesium chloride hexahydrate (MgCl2∙6H2O, 99–102%); magnesium sulphate (MgSO4, 99%); magnesium nitrate hexahydrate (Mg(NO3)2∙6H2O, 99%) were provided by REACTIVUL Bucuresti (Bucharest, Romania). Potassium ferrocyanide K4[Fe(CN)6] and L(+)-Ascorbic acid (C6H8O6, AA, ≥99%) were acquired from Merck (Darmstadt, Germany). Sodium acetate anhydrous (CH3COONa, ≥99.0%) was purchased from ChimReactiv SRL (Bucharest, Romania). N,N-dimethylformamide (DMF) was acquired from Fluka Chemie GmbH (Buchs, Switzerland), while boric acid (H3BO3, 99%) was provided by Andra Chim SRL (Bucharest, Romania). The MQuant® Nitrite Test (Merck KGaA, Darmstadt, Germany) was employed for UV-Vis investigation of nitrite solutions. Deionized water with a resistivity of at least 18.2 MΩ × cm was used to prepare all solutions.
3
Synthesis of Nitrogen-Doped Graphene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Potassium ferrocyanide-K4[Fe(CN)6] and potassium chloride (KCl) were purchased from Merck (Germany). N,N-dimethylformamide (DMF) was bought from Sigma-Aldrich (Germany). 8-hydroxy-2’-deoxyguanosine (8-OHdG) was purchased from the Cayman Chemical Company. For the synthesis of nitrogen-doped graphene the following chemicals were used: graphene oxide, prepared using a modified Hummers method as previously reported [42 (link)], and urea (Alfa-Aesar, Germany).
4
Electrochemical Exfoliation of Graphite
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
8-hydroxy-2′-deoxyguanosine (8-OHdG) was purchased from Cayman Chemical Company. Boric acid (H3BO3), sodium chloride (NaCl), monobasic sodium phosphate (NaH2PO4), and dibasic sodium phosphate (Na2HPO4) were bought from REACTIVUL Bucuresti (Bucharest, Romania). Potassium ferrocyanide K4[Fe(CN)6] and KCl were purchased from Merck. Dimethylformamide (DMF) was purchased from JTBaker (HPLC grade). High-purity (99.9995%) graphite rods were employed for electrochemical exfoliation and were bought from Alfa-Aesar (Kandel, Germany).
5
Indole-based Nanomaterial Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Indole (Distilled), hydrochloric acid and potassium ferrocyanide [K4Fe(CN)6] were purchased from Merck, India. Chloroauric acid (HAuCl4) was gotten from SRL, Sisco India Ltd. KMnO4, H2SO4 and dimethyl formamide (DMF) were purchased from Central Drug House, India. Glucose oxidase (GOx) (Activity 100,000–150,000 units g−1 protein) from Aspergillus niger, the ferritin (10 mg mL−1 in 0.15 M NaCl) from stallion spleen, glutaraldehyde and graphene utilized were acquired from Sigma-Aldrich Chemicals, India. Phosphate buffers of pH 5.0 and 7.0 (Otto Pvt. Ltd. India), and D-(+)-glucose anhydrous (Himedia Laboratories Pvt. Ltd. India) were utilized as gotten. All other reagents utilized were of analytical grade. Distilled water was utilized all through the tests.
6
Synthesis of Nanocomposite Biosensor
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hemp
fiber was provided as a gift from a local farm in Thailand. Chemical
reagents including sodium hydroxide (NaOH; 98%), hydrogen peroxide
(H2O2), potassium ferricyanide K3[Fe(CN)6], and potassium ferrocyanide K4[Fe(CN)6] were purchased from Merck Darmstadt, Germany. Sodium sulfate
anhydrous (Na2SO4) was obtained from Elago Enterprises
Pty, Co., Ltd. PVA with a molecular weight of 100,000 g/mol was purchased
from Chem-Supply Pty, Ltd., Australia. Glutaraldehyde solution (25%
of concentration) for the synthesis (C5H8O2) was obtained from ITW Reagents, S.R.L., Co. Ltd., Germany.
Silver nitrate (AgNO3), lactate oxidase (LOx) from Aerococcus viridans, sodium DL-lactate, and phosphate
buffer (PB, 0.1 M, pH 7.4) were obtained from Sigma-Aldrich (St. Louis,
MO, USA). Potassium chloride (KCl) was purchased from Ajax Fine Chem,
Co., Ltd. All chemicals were of analytical grade and used as received
without further purification.
fiber was provided as a gift from a local farm in Thailand. Chemical
reagents including sodium hydroxide (NaOH; 98%), hydrogen peroxide
(H2O2), potassium ferricyanide K3[Fe(CN)6], and potassium ferrocyanide K4[Fe(CN)6] were purchased from Merck Darmstadt, Germany. Sodium sulfate
anhydrous (Na2SO4) was obtained from Elago Enterprises
Pty, Co., Ltd. PVA with a molecular weight of 100,000 g/mol was purchased
from Chem-Supply Pty, Ltd., Australia. Glutaraldehyde solution (25%
of concentration) for the synthesis (C5H8O2) was obtained from ITW Reagents, S.R.L., Co. Ltd., Germany.
Silver nitrate (AgNO3), lactate oxidase (LOx) from Aerococcus viridans, sodium DL-lactate, and phosphate
buffer (PB, 0.1 M, pH 7.4) were obtained from Sigma-Aldrich (St. Louis,
MO, USA). Potassium chloride (KCl) was purchased from Ajax Fine Chem,
Co., Ltd. All chemicals were of analytical grade and used as received
without further purification.
7
Aptamer-Based HER2 Oncomarker Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pencil graphite type HB with a diameter of 2.0 mm was purchased from Rotring Co. Ltd, Germany. 3-Mercaptopropionic acid (MPA), N-HydroxySuccinimide (NHS), Bovine Serum Albumin (BSA), Human Serum Albumin (HSA) 1-ethyl-3-(3-dimethylaminopropyl) Carbodiimide hydrochloride (EDC), Rhodium(III) Chloride (RhCl3, 98%), and HER2 ELISA assay Kit (for serum, plasma, urine, and etc.) was procured from Sigma-Aldrich, USA. Potassium ferricyanide (k3Fe(CN)6), and Potassium ferrocyanide (K4Fe(CN)6) were obtained from Merck, Germany. Anti-HER2 aptamer specifically bind to HER2-ECD oncomarker was obtained from Bio Basic Inc, Canada. The sequence of Amine-terminated HER2 DNA aptamer (Apt) consists of 54-mer oligonucleotide bases is 5′-(NH2-(CH2)6-GGG CCG TCG AAC ACG AGC ATG GTG CGT GGA CCT AGG ATG ACC TGA GTA CTG TCC)-3′. This anti-HER2 DNA aptamer sequence was selected by serial evolution of ligands in vitro by exponential enrichment (SELEX) process51 (link),55 (link). The recombinant human HER2/ErBb2/CD340 oncomarker was procured from Sigma-Aldrich, USA. Sulfuric Acid (H2SO4 98%), Hydrochloric Acid (HCl 37%), and Ethanol (99.8%), were purchased from Merck, Germany. Other analytical grade reagents were obtained of the highest level of purity and all required solutions were prepared from double distilled water.
8
Graphene Oxide-Based Aptamer Biosensor
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The CFX aminated aptamers used in this experiment have been obtained from Bioneer (South Korea) with the following sequences:23 (link)(5′-NH2 modified) 5′-ATACCAGCTTATTCAATTGCAGGGTATCTGAGGCTTGA
TCTACTAAATGTCGTGGGGCATTGCTATTGGCGTTGATACGTACAATCGTAA
TCAGTTAG-3′.
The polyethyleneimine (PEI, branched, Mw 10 000) and graphene oxide (GO) powder were ordered from Sigma-Aldrich (Shanghai, China). Tris–HCl (hydroxymethyl), MCH (mercaptoethanol), disodium hydrogen orthophosphate, potassium ferrocyanide K4Fe(CN)6, potassium ferricyanide K3Fe(CN)6, hydrogen tetrachloroaurate(iii ) hydrate (HAuCl4·3H2O), potassium chloride (KCl), serine, valine, cysteine, methionine, and glutamine were acquired from Merck (Darmstadt, Germany). Supporting electrolyte was freshly prepared at pH = 7.4 in concentration of 0.01 M K4Fe(CN)6/K3Fe(CN)6 (1 : 1) with 0.1 M KCl solution. Other reagents and chemicals were of analytical grade and utilized without further purification. Local and pasteurized milk samples from different supermarkets were randomly collected in Tabriz, Iran.
TCTACTAAATGTCGTGGGGCATTGCTATTGGCGTTGATACGTACAATCGTAA
TCAGTTAG-3′.
The polyethyleneimine (PEI, branched, Mw 10 000) and graphene oxide (GO) powder were ordered from Sigma-Aldrich (Shanghai, China). Tris–HCl (hydroxymethyl), MCH (mercaptoethanol), disodium hydrogen orthophosphate, potassium ferrocyanide K4Fe(CN)6, potassium ferricyanide K3Fe(CN)6, hydrogen tetrachloroaurate(
9
Electrochemical Sensing of Sunset Yellow
10
Electrochemical Prussian Blue Sensor
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sodium azide, potassium ferrocyanide
(K4[Fe(CN)6]), 30% HCl,
FeCl3, soluble Prussian blue nanoparticles, ascorbic
acid, and chloroform were obtained from Sigma-Aldrich (St. Louis, MO, USA). KCl,
NaCl, Na2HPO4, and
KH2PO4 were purchased from
Merck (Darmstadt, Germany). H2O235% w/w was obtained from Alfa Aesar (Kandel, Germany), and ferricyanide
(K3Fe(CN)6) from AppliChem,
PanReac (Darmstadt, Germany). Phosphate buffer saline (PBS) was prepared using
high-purity, 18.2 MΩ cm resistivity, Milli-Q water. PBS (pH 7.4) comprised
130.9 mM NaCl, 5.1 mM Na2HPO4, and
1.5 mM KH2PO4.
(K4[Fe(CN)6]), 30% HCl,
FeCl3, soluble Prussian blue nanoparticles, ascorbic
acid, and chloroform were obtained from Sigma-Aldrich (St. Louis, MO, USA). KCl,
NaCl, Na2HPO4, and
KH2PO4 were purchased from
Merck (Darmstadt, Germany). H2O235% w/w was obtained from Alfa Aesar (Kandel, Germany), and ferricyanide
(K3Fe(CN)6) from AppliChem,
PanReac (Darmstadt, Germany). Phosphate buffer saline (PBS) was prepared using
high-purity, 18.2 MΩ cm resistivity, Milli-Q water. PBS (pH 7.4) comprised
130.9 mM NaCl, 5.1 mM Na2HPO4, and
1.5 mM KH2PO4.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!