Human NP cells were acquired from ScienCell Research Laboratories (Carlsbad, CA, USA). and cultivated in NP cell culture medium (ScienCell Research Laboratories). The cells were incubated in a humidified environment (37° C, 5% CO2). NP cells were first separated from the nucleus pulposus of human intervertebral discs. An IDD cell model was established by treating NP cells with IL-1β (5, 10, 20, 50 ng/ml) [17 (link)] or H2O2 (10, 25, 50, 100 μM) [18 (link)] for 24 hours. IL-1β (Order No. C600002) was purchased from Sangon Biotech (Shanghai, China) and H2O2 (Order No. 1.08600) was produced by Sigma-Aldrich (St. Louis, MO, USA). The Sirt1 activator resveratrol (Resv, Cat. HY-16561, MedChemExpress, Monmouth Junction, NJ, USA) was used to activate Sirt1 in NP cells at a dose of 30 μM [19 (link)].
Human np cells
Manufactured by ScienCell
Sourced in United States
Human NP cells are primary neural progenitor cells derived from human sources. These cells are capable of self-renewal and can differentiate into various neural cell types, such as neurons and glial cells. The core function of these cells is to serve as a model system for studying neural development, differentiation, and function.
Automatically generated - may contain errors
Lab products found in correlation
Human np cell medium, by ScienCell (3 mentions)
Humidified cell incubator, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Tnf α, by Novoprotein (1 mentions)
Penicillin, by Harvard Bioscience (1 mentions)
Streptomycin, by Harvard Bioscience (1 mentions)
Human chondrocytes, by Provitro (1 mentions)
Growth supplement, by ScienCell (1 mentions)
Il 1β, by Merck Group (1 mentions)
T 75 flask, by Merck Group (1 mentions)
Mic 101, by Embrient Inc (1 mentions)
Poly l lysine (pll), by ScienCell (1 mentions)
Hoechst staining kit, by Beyotime (1 mentions)
Annexin 5 fluorescein isothiocyanate fitc propidium iodide kit, by BD (1 mentions)
Pbs phosphate buffered saline, by Thermo Fisher Scientific (1 mentions)
Z devd fmk, by MedChemExpress (1 mentions)
Tnf α, by Thermo Fisher Scientific (1 mentions)
Caspase 3 activity kit, by Beyotime (1 mentions)
Ici 182 780, by Merck Group (1 mentions)
9 protocols using human np cells
1
Establishing an Intervertebral Disc Degeneration Cell Model
2
Rat and Human Nucleus Pulposus Cell Cultures
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The experiments were approved by the Ethics Committee of Sun Yat-sen Memorial Hospital, Sun Yat-sen University (No. [2020]-405), and the Animal Care and Use Committee of Sun Yat-sen University (No. SYSU-IACUC-2020-B0933). Rat NP tissue was collected, cut into pieces and digested into cells which were then cultured in DMEM (HyClone, Logan, USA) with 10% FBS (Gibco, New York, USA), penicillin G in a humidified cell incubator (Thermo Fisher Scientific, Waltham, USA). Human NP cells were obtained from ScienCell (ScienCell, San Diego, USA) with authentication. NF-κB activator 1 (MedChemExpress, Princeton, USA) was added after TNF-α (Novoprotein, Suzhou, China) stimulation of rat NP cells.
3
Culturing Stem Cells and Disc Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human mesenchymal stem cells with reverse telomerase transcriptase (hMSC-TERT) [34 (link)] were cultured in Eagle’s minimal essential medium (EMEM; PAA, Pasching, Austria) supplemented with 10% foetal bovine serum (FBS; PAA), 100 U/mL penicillin and 100 μg/mL streptomycin (both Biochrom, Berlin, Germany) as previously described [35 (link)]. Human NP cells (male, foetal, 20 weeks old) were obtained from ScienCell (Carlsbad, CA, USA) and expanded in Human Nucleus Pulposus Cell Medium containing 2% FBS and 1% growth supplement (ScienCell). Human chondrocytes (male, 65 years old) were obtained from Provitro (Berlin, Germany) and cultured in Chondrocyte Growth Medium containing 10% FBS (Provitro). All three cell types were cultured in different culture formats (25-300 cm2 flasks) in a humidified incubator at 37°C with a 5% CO2 atmosphere. Cells were passaged at 80% confluency and used during passages 69–75 (hMSC-TERT), 2-8 (NP cells) and 5-7 (chondrocytes). Cell morphology was analysed using a wide-field microscope.
4
Modulation of NP Cell Function
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human NP cells were purchased from ScienCell, Carlsbad, CA, and cultured in human NP cell medium (ScienCell) at 37 °C in 5% CO2 as previously described [20 ]. Lentivirus-mediated stably overexpressed or knockdown of KLF10 in NP cells were constructed according to the manufacturer's instructions (GenePharma, Shanghai, China). The target sequences of KLF10-shRNAs were as follows: KLF10 shRNA1 GCAAGAAAGAACATACCATGT, KLF10 shRNA2 GGAGTGACCATTTGACCAAGC. The efficiency of overexpressed and knocked down cells was certified by qRT-PCR and immunoblotting. After transfection, NP cells were treated with or without 10 ng/ml of interleukin-1β (IL-1β, Sigma) and 300 nmol/L of LY364947(a TGF-β Receptor I Kinase Inhibitor, APExBIO) in the culture medium for 12 h.
5
Human NP Cell Culture and Treatment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human NP cells were obtained from ScienCell (Carlsbad, CA, USA) and cultured in Human NP Cell medium (ScienCell) at 37°C/5% CO2. The medium was changed every 3 days. When the cells reached 80–90% confluence, they were trypsinized, counted, and plated again at a density of 1.5×106 cells/ml. A total of 12 h after plating, cells were treated with or without 10 ng/ml IL-1β, 100 µg/ml purified collagen type II, and/or vehicle (0.05 M acetic acid, as used for collagen type II dissolution) for 48 h and then used in subsequent experiments.
6
Human NP Cell Culture Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human NP cells were obtained from ScienCell (Carlsbad, CA, USA). Cells were cultured at 37˚C/5% CO2 by using human NP cell medium (ScienCell) and the cell medium was changed every 3 days. Cell trypsinization, counting and passaging were performed when NP cells reached 80%-90% confluence. Cells from passages 3-6 were cultured in 6-well plate at a density of 1.5 × 106 cells/ml. At 12h after plating, cells were given the indicated treatment for subsequent experiments.
7
Intervertebral Disc Degeneration Induction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human NP cells (ScienCell, USA) was cultured at specific medium containing 10% fetal bovine serum (FBS), 1% NP cell growth supplement and 1% penicillin/streptomycin in 5% CO2 at 37°C (ScienCell, USA). When cells adhered to the wall up to 80%, IL-1β (Reprotech, USA) was added into the medium to induce degeneration of NP cells for 24 hours, the concentration of which was 10 ng/mL as described in previous studies [7 (link),21 (link),22 (link)].
8
Cultivation of Fetal Nucleus Pulposus Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human NP cells (4800, ScienCell) were cultured in a T75 flask (CLS430641U, Sigma Aldrich) coated with 15 μg of Poly‐L‐Lysine (0413, ScienCell). NP cells were cultured in Complete Nucleus Pulposus Cell Media (4801, ScienCell) which was changed every 2 to 3 days. The NP cells were grown to confluency in hypoxia (3.5% oxygen, 10% CO2, 86.5% N2) in a modular incubator chamber (MIC‐101, Billups‐Rothenberg) before being used. Cells from passages 2 and 3 from multiple freeze downs were used in these experiments. These cells were acquired from single, fetal donors, and the identity of the cells was verified by the company through immunofluorescence with antibodies for fibronectin and vimentin (ScienCell).
9
Evaluating Apoptosis in NP Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human NP cells, NP Cell Growth Supplement and NP cell medium (NPCM) were purchased from ScienCell Research Laboratories, Inc. (Carlsbad, CA, USA), and Dulbecco's modified Eagle's medium (DMEM)/F-12 and fetal bovine serum (FBS) were obtained from HyClone; Thermo Fisher Scientific, Inc. (Waltham, MA, USA). Trypsin, Cell Counting kit-8 (CCK-8) and 17β-E2 were purchased from Sigma-Aldrich; Merck KGaA (Darmstadt, Germany). PBS (phosphate buffered saline) was obtained from Gibco; Thermo Fisher Scientific, Inc. The Annexin V-Fluorescein Isothiocyanate (FITC)/Propidium Iodide (PI) kit was purchased from BD Biosciences (Franklin Lakes, NJ, USA), and the caspase-3 activity kit, Hoechst staining kit and cell lysis buffer for western and immunoprecipitation were obtained from Beyotime Institute of Biotechnology (Shanghai, China). Z-DEVD-FMK was purchased from MedChem Express (Monmouth Junction, NJ, USA), ICI 182,780 was obtained from Sigma-Aldrich, Merck KGaA; and TNF-α was purchased from PeproTech, Inc. (Rocky Hill, NJ, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!