Ni nta affinity chromatography

His-tagged proteins were purified from the supernatant by gravity-flow Ni-NTA affinity chromatography (Qiagen). Where indicated, affinity tags were cleaved from the fusion proteins by TEV protease treatment at a 1:30 molar ratio of protease to protein, while dialyzing in the lysis buffer for 16 h at 4 °C. Affinity tags were removed by Ni-NTA affinity chromatography and the proteins of interest were collected in the flow-through. Proteins were then concentrated and further purified by either S75 or S200 size-exclusion column chromatography in the indicated assay buffer. Peak A₂₈₀ fractions were concentrated, flash-frozen, and stored at −80 °C.

To purify the S. aureus Newman-encoded NWMN_0824 as a
polyhistidine-tagged variant (designated as rCyp), the Newman
genomic DNA was amplified using the oligonucleotides 824-1
(5’CTAGCTAGCGCTAACTATCCACAGTTAAAC) and 824-2 (5’
CCGCTCGAGTTATTCTTCAACATCAATAGATTC) as
described [9 (link)]. The resulting 593 bp DNA fragment was cloned to
plasmid pET28a (Novagen) using a standard method [9 (link),10 (link)]. The
yielded plasmid that carries no mutation in the cloned DNA
insert was designated as p1350. Cloning has linked twenty-three
extra amino acid residues (including six consecutive histidine
residues) at the N-terminal end of SaCyp. Transforming E. coli
BL21 (DE3) with p1350 as stated [9 (link)] created SAU1350.
Protein rCyp was purified from SAU1350 using a standard
procedure with minor modifications [9 (link)]. Briefly, the IPTGinduced
SAU1350 cells in buffer A [20 mM Tris-HCl (pH 8.0), 300
mM NaCl, 10 mM imidazole, 5% glycerol and 10 μg/ml PMSF]
were ruptured followed by the purification of rCyp from the
resulting supernatant by Ni-NTA affinity chromatography
(Qiagen). The eluted rCyp was dialyzed against buffer B [20 mM
Tris-HCl (pH 8.0), 1 mM EDTA, 300 mM NaCl, and 5% glycerol]
as described [10 (link)]. The molar concentration of rCyp was
determined using the molecular mass of its monomeric form.

RS107_6 was PCR amplified using high-fidelity polymerase (QIAGEN, Hilden, Germany) with specific primers containing BamHI and HindIII. Further, the PCR amplified RS107_6 gene and pET-28a(+) were double-digested with BamHI and HindIII, followed by ligation and transformation into the E. coli BL21 (DE3) strain (Invitrogen, Waltham, MA, USA). The orientation of the target gene in the recombinant plasmid pET-28 a(+)/RS107_6 was confirmed by sequencing using T7 primers and SnapGene version 6.2. The expression of the recombinant protein was induced with isopropyl β-1-D-thiogalactopyranoside (IPTG; 0.1 mM) overnight at 16 °C. The expressed protein was purified using Ni-NTA affinity chromatography (QIAGEN, Hilden, Germany). The histidine-tagged protein bound to the matrix was eluted and dialyzed with 1X Tris buffer, pH 7.5 (50mM Tris-HCl) for 24 h at 4 °C. Total protein concentration was estimated using the Bradford method [31 (link)]. The expression and purity of the recombinant protein were analyzed using SDS-PAGE, followed by staining with Coomassie Brilliant Blue R-250.

The DNA fragments encoding the P domain of HuNV GII.4 (Hu/GII.4/Hiroshima/55/2005/JPN; GenBank accession number BAI49908.1) were synthesized by Macrogen (Seoul, Korea). The GII.4 P domain was expressed and purified as previously described, with minor modifications [24 (link)]. The gene was cloned into the pET14b vector (Novagen, Madison, WI, USA) and transformed into Escherichia coli BL21 (DE3) competent cells (Novagen). The cells were centrifuged at 3500× g for 15 min and sonicated, and then centrifuged at 12,000× g for 20 min. The supernatant containing the GII.4 P domain was purified by Ni-NTA affinity chromatography (Qiagen, Hilden, Germany) and Superdex 200 chromatography (GE Healthcare, Uppsala, Sweden).

The RlmCD (sp_1029) ORF was amplified from S. pneumoniae genomic DNA via PCR. The full-length RlmCD (residue 1–543) and C-terminal truncated RlmCD (residue 1–454) were subcloned into a modified pET28a (Novagen) vector with an 8×His-SUMO tag and a ULP1 cleavage site (pET-SUMO vector) at the N terminal site. All single residue mutants were generated using MutanBEST kit (TaRaKa) and verified by DNA sequencing. The plasmids were transformed into E. coli BL21-Gold (DE3) cells.
For wild-type and mutant protein expression, cells were grown in LB medium at 37°C until the OD₆₀₀ reached 0.8, and isopropyl β-D-1-thiogalactopyranoside (IPTG) was added to a final concentration of 0.2 mM. After induction, cells were grown at 16°C for an additional 24 hours before harvesting. The cell pellets were suspended with binding buffer (20 mM Tris-HCl, 2 M NaCl, pH 8.0), and lysed by sonication. After centrifugation, the supernatant was purified using Ni-NTA affinity chromatography (Qiagen). The eluted SUMO-tag protein was loaded on Superdex 200(16/60) (GE healthcare) equilibrated with binding buffer for further purification. The elution sample was mixed with ULP1 enzyme against storage buffer (20 mM Tris-HCl, 250 mM NaCl, pH 8.0) to remove the SUMO tag. After overnight cleavage, the mixture was further purified by Superdex 200(16/60) (GE healthcare), again with storage buffer.

The expression host used in this paper was the previously constructed E. coli BL21 (DE3) with the recombinant plasmid [25 (link)]. A single colony was selected and incubated in 5 mL of lysogeny broth (LB) containing 100 mg/L ampicillin at 37 °C and 220 rpm for 12 h to obtain the seed medium. Subsequently, 1 mL of the seed culture was transferred into 50 mL LB medium containing 100 mg/L ampicillin for fermentation. When the OD₆₀₀ of the culture reached 0.6, IPTG was added at final concentrations of 0.1, 0.25, 0.5 and 1 mM, respectively. In addition, a final concentration of 1 mM CuSO₄ was added to each medium, and the cultures were fermented at 16 °C for 20 h. After fermentation, the culture was centrifuged at 8000 rpm and 4 °C for 10 min to obtain the supernatant, which was then purified using Ni⁺-NTA affinity chromatography (Qiagen, Hilden, Germany) to obtain the target protein as previously described [25 (link)]. Protein concentrations were measured with a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) at 280 nm.