Nhs activated sepharose 4 fast flow

Antibodies against β-actin (MAB1501R, dilution 1:500), Flag-tag (M2, dilution 1:1,000) and HA-tag (#561, dilution 1:500) were purchased from Chemicon, Sigma and MBL (Japan), respectively. The other antibodies against the proteasome subunits used in this study were described previously13 (link)43 (link) and used at a 1:1,000 dilution. Hybridoma cells (28-14-8 and Y3) were purchased from ATCC. Antibodies were purified from culture supernatants using protein G-Sepharose (GE Healthcase) and conjugated to NHS-activated Sepharose 4 Fast Flow (GE Healthcare), according to the manufacturer's protocol.

Following the EMARS reaction, the precipitated cell membrane pellet was mixed with chloroform and methanol in a 2:1 volume ratio. Deionized water was then added, and gentle agitation was done. All the solvent was removed, and the resulting pellets were washed thrice with 40% methanol to completely remove excess FT. To remove any residual solution completely, the specimens were evaporated and solubilized with 100 μl of 50 mM Tris–HCl (pH 7.4), containing 1% SDS, at 95 °C for 5 min. The soluble material was transferred into a new tube and then diluted with 400 μl NP-40 lysis buffer. Then, 20 μl of the prepared anti-fluorescein antibody Sepharose, which was produced by the conjugation reaction between anti-fluorescein antibody (SouthernBiotech) and NHS-activated Sepharose 4 Fast Flow (GE Healthcare Life Sciences), was added to the sample, which was mixed with rotation using rotator at 4 °C overnight. After washing resins with the NP-40 lysis buffer five times and 0.5 M NaCl-PBS two times, a 1% SDS solution, containing MPEX PTS reagent (GL Sciences), was added to resins for MS analysis. The samples were then heated at 95 °C for 5 min to elute the fluorescein-labeled molecules from resins.

Human and mouse serum albumin (HSA and MSA, respectively; Sigma Aldrich, Atlanta, GA, USA) and BSA were dissolved in PBS (final concentration, 2.5% (w/v)) and mixed with glutaraldehyde (Sigma Aldrich) at a final concentration of 0.2% (v/v) to allow polymerization. After incubation at room temperature for 4 h, mixtures were dialyzed against PBS overnight at 4 °C. Subsequently, 100 µg of HSA, MSA, BSA, as well as polymerized HSA, MSA, and BSA (pHSA, pMSA, and pBSA, respectively), were individually coupled to 200 µL of N-hydroxysuccimide (NHS)-activated Sepharose 4 Fast Flow (GE Healthcare, Buckinghamshire, UK; 50% slurry). PAR-deleted BNCs (ΔBNCs, BNCs lacking a large part of the pre-S region from Met-1 of the pre-S1 region to Arg-18 of the pre-S2 region [40 (link)]) were prepared by incubating BNCs with 0.2% (w/w) trypsin (Sigma Aldrich) at 37 °C for 1 h. Each albumin-conjugated resin (20 µL) was incubated with 40 µg of either BNCs or ΔBNCs in 100 µL of PBS at 37 °C for 1 h, washed with PBS 4 times, subjected to 0.1% (w/v) sodium dodecyl sulfate-12% (w/v) polyacrylamide gel electrophoresis (12% SDS-PAGE), followed by silver staining. The amounts of BNCs and ΔBNCs bound to albumin-conjugated resins were determined by densitometry using a luminescent image analyzer (LAS-4000mini; Fujifilm, Tokyo, Japan).

Cholesterol, U18666a, sodium taurocholate, mono-olein, oleic acid, phosphatidyl-choline (2-oleoyl-1-palmityl-sn-glycero-3-phosphocholine) were from Sigma-Aldrich (St. Louis, MO); ezetimibe and lysophosphatidylcholine (1-palmitoyl-sn-glycero-3-phosphocholine) were from Santa Cruz Biotechnology (Santa Cruz, CA); Ni-NTA resin was from Qiagen (Valencia, CA), NHS-activated Sepharose 4 Fast Flow and Q-Sepharose Fast Flow was from GE Healthcare Life Sciences. ³H-Cholesterol was from American Radiolabeled Chemicals (St. Louis, MO) and ³H-ezetimibe was from Merck. EZ-link Sulfo-NHS-SS-Biotin, SF900 III SFM insect cell medium, Freestyle 293 expression medium, Dulbecco’s modified Eagle’s medium (DMEM) and neutravidin agarose were from Life Technologies (Carlsbad, CA); lipoprotein-deficient serum was from KALEN Biomedical (Montgomery Village, Maryland). Chicken anti-GFP antibodies were from Life Technologies (used at 1:1000 for immunoblots). IRDye 680RD donkey anti-chicken and IRDye 800CW streptavidin were from LI-COR (Lincoln, NE) and used at 1:10,000 for immunoblots. Mouse anti-GFP antibody was from NeuroMab and Rabbit anti-LAMP1 antibody was obtained from Novus; both were used at 1:1000 for immunofluorescence. Alexa Fluor 488 Goat anti-mouse antibody and Alexa Fluor 568 Goat anti-rabbit antibody were obtained from Life Technologies and used at 1:2000 for immunofluorescence.

Five milliliters of drained NHS-Activated Sepharose 4 Fast Flow (GE Healthcare Life Sciences) were washed 10 times with 15 mL of cold 1 mM HCl and then suspended in 2.5 mL of 0.2 M NaHCO₃, 0.5 M NaCl, 3% DMSO, pH 8.3 (coupling buffer), containing 0.4 M p-amino cinnamic acid (p-ACA). The suspension was mixed in a rotary shaker overnight at 4°C. After removal of the coupling mixture, the remaining unreacted groups were blocked with 0.5 M ethanolamine, 0.5 M NaCl, pH 8.3 (5 mL) and 10 subsequent washing steps were performed according to the manufacturer's instructions. The matrix (p-ACA/matrix) was stored in 20% ethanol (3 mL) at 4°C. To generate the control matrix (EA/matrix), p-ACA was omitted in the coupling mixture.

Mouse liver total RNA was separated by anion exchange chromatography with DEAE Sepharose Fast Flow (GE Healthcare, Chicago, IL, USA) to obtain crude tRNAs with removal of polysaccharides and rRNA [66 (link)]. Cytoplasmic tRNA^[Ser]Sec was isolated from the crude tRNAs by reciprocal circulating chromatography, as described in [48 (link)]. The 5′-EC amino-modified DNA probe (Sigma-Aldrich, St. Louis, MI, USA), TGGGCCCGAAAGGTGGAATTGAACCACTCTGTCGCTAGAC was covalently immobilized on NHS-activated Sepharose 4 Fast Flow (GE Healthcare, Chicago, IL, USA). About 6 μg of tRNA^[Ser]Sec were obtained from 1.4 mg crude tRNAs. Mouse tRNA^[Ser]Sec was digested by RNase T1 (Thermo Fisher Scientific, Waltham, MA, USA), and subjected to capillary liquid chromatography (LC) coupled to nano electrospray (ESI)/mass spectrometry (MS) on a linear ion trap-Orbitrap hybrid mass spectrometer (LTQ Orbitrap XL; Thermo Fisher Scientific, Waltham, MA, USA), as described in [49 ,50 (link)]. The RNA fragments were scanned in a negative polarity mode over a range of m/z 600–2000.