Total RNA was extracted from embryo heads at the indicated developmental stages using a Sepasol RNA I Super (Nacalai, Japan). cDNA synthesis was carried out from 500 ng of RNA using Toyobo ReverTra Ace qPCR RT master mix with gDNA remover, according to the manufacturer’s instructions. Expression profiles of the genes listed below were analyzed with the specified primers using Luna Universal qPCR Master Mix (NEB). Quantitative RT-PCR was performed using StepOnePlus (Applied Biosystems). Relative expression was calculated using the ΔΔCt method with the reference gene ef1α. Primers used in qRT-PCR analysis; mdm2 (Wilkins et al., 2013 (link)), p21(cdkn1a) (Stiff et al., 2016 (link)), FL tp53 and ∆113 tp53 (Chen et al., 2016 (link)), ef1α (McCurley and Callard, 2008 (link)). All the primer sequences of ccng1, mdm2, p21 (cdkn1a), FL tp53, ∆113 tp53, puma (bbc3), cenpt, ncapg, atm, atr, wrnip1, and ef1α are provided in Key Resources Table.
Sepasol rna 1 super
Manufactured by Nacalai Tesque
Sourced in Japan
The Sepasol-RNA I Super is a laboratory product designed for the extraction and purification of RNA from various biological samples. It serves as a tool for researchers and scientists in the field of molecular biology and genetics.
Automatically generated - may contain errors
Lab products found in correlation
Revertra ace, by Toyobo (11 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (6 mentions)
Rq1 rnase free dnase, by Promega (5 mentions)
Revertra ace qpcr rt master mix, by Toyobo (3 mentions)
Luna universal qpcr master mix, by New England Biolabs (3 mentions)
Genequant pro, by Cytiva (3 mentions)
Ptc 100 programmable thermal controller, by Bio-Rad (3 mentions)
Ptc 100, by Bio-Rad (3 mentions)
Primescript rt reagent kit, by Takara Bio (3 mentions)
Steponeplus, by Thermo Fisher Scientific (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Sybr premix ex taq, by Takara Bio (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Tb green premix ex taq, by Takara Bio (2 mentions)
Icycler system, by Bio-Rad (2 mentions)
Reverse transcription buffer, by Toyobo (2 mentions)
Oligo dt 20, by Toyobo (2 mentions)
Nanodrop lite, by Thermo Fisher Scientific (2 mentions)
1urq1 dnase stop solution, by Promega (2 mentions)
Deoxyribonucleotide triphosphate dntp mixture, by Toyobo (2 mentions)
38 protocols using sepasol rna 1 super
1
Quantitative Analysis of p53 Signaling Pathway
2
Thecal Layer Isolation and RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Thecal layers of F1 follicles were isolated and washed in PBS. Briefly, the superficial tissues were removed, followed by cutting the stigma to release the yolk and granulosa layer. The obtained thecal layer was separated into two pieces by cutting vertically, i.e., from the basal (where the stalk was located) to the apical stigma region. Total RNA was extracted from half of each theca using Sepasol RNA I Super (Nacalai Tesque Inc., Kyoto, Japan) and a Polytron™ homogenizer (Polytron™ PT1200ci Kinematica AG, Luzern, Switzerland). The RNA samples were then dissolved in TE buffer (10 mM Tris, pH 8.0, with 1 mM EDTA). The concentration of RNA in each sample was measured using Gene Quant™ Pro (Amersham PharmaciaBiotech, Cambridge, UK). The RNA samples were mixed with RQ1 RNase-free DNase (Promega Co., Madison, WI, USA) and incubated in a PTC-100 programmable thermal controller (MJ Research, Inc., Waltham, MA, USA) at 37°C for 45 min. The RNA samples were then reverse-transcribed using ReverTra Ace® (Toyobo Co., Ltd, Osaka, Japan) at 42°C for 30 min, followed by heat inactivation at 99°C for 5 min on the PTC-100 programmable thermal controller (MJ Research, Inc.). The reaction mixture (10 µL) contained 1 µg of purified RNA, 1 × RT buffer, 1 mM dNTP mixture, 20 U RNase inhibitor, 0.5 mM oligo(dT)20 primer, and 50 U ReverTra Ace.
3
Transcriptome Profiling by RNA-seq
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction and cDNA preparation were carried out as described previously with a few modifications [31 (link)]. Total RNA was isolated using Sepasol RNA I Super (Nakalai Tesque), and used for cDNA synthesis using ReverTra Ace qPCR RT master mix with genomic DNA remover KIT (Toyobo). Depletion of rRNA was performed using the Ribo-Zero rRNA removal kit for human/mouse/rat (Epicentre). Indexed RNA-seq libraries were prepared with the NEBNext Ultra™ RNA Library Prep Kit for Illumina kit (New England Biolabs) or NEXTflex™ Directional RNA-Seq Kit (BIOO Scientific Corp.) according to the manufacturer’s instructions. Fragment size selection of RNA-seq libraries was done using Agencourt AMPure XP beads. The products were purified and enriched with PCR to create the final double stranded cDNA library. The MiSeq system (Illumina) was used to sequence the cDNA library.
4
Quantitative Analysis of RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Sepasol RNA I Super (Nacalai Tesque) and then was reverse transcripted into cDNA with High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). mRNA levels were measured by qRT-PCR using Luna Universal qPCR Master Mix (New England Biolabs), and normalized with those of gapdh. Sequences of primers used in this are: p21-forward, 5′-GAGGCCGGGATGAGTTGGGAGGAG-3′ and p21-reverse, 5′-CAGCCGGCGTTTGGAGTGGTAGAA-3′; Puma-forward, 5′-TTGTGCTGGTGCCCGTTCCA-3′ and Puma-reverse, 5′-AGGCTAGTGGTCACGTTTGGCT-3′; gapdh-forward, 5′-AACAGCCTCAAGATCATCAGC-3′, and gapdh-reverse, 5′-GGATGATGTTCTGGAGAGCC-3’.
5
Quantitative RNA Expression Analysis in Tumor Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tumor cells using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA) and from frozen tumor tissues using Sepasol-RNA I Super (Nacalai Tesque, Kyoto, Japan) according to the manufacturer’s protocol and subsequently purified with the DNA-free™ DNA Removal kit (Ambion, Austin, TX, USA). The quality of the total RNA was verified using the 260/280 nm ratio and a NanoDrop 2000 (Thermo Fisher Scientific, Wilmington, DE, USA). qRT-PCR was performed using a TaqMan system on an Applied Biosystems StepOne™ machine (Carlsbad, CA, USA) according to the manufacturer’s instruction. Target-specific primers and probes for human GRM1 (Hs00168250_m1), 53BP1 (Hs00996827_m1), CDKN1A (Hs00355782_m1), IL-6 (Hs00174131_m1), CXCL8 (Hs00174103_m1), TNF-α (Hs00174128_m1), VEGFA (Hs00900055_m1), MET (Hs01565584_m1) and 18S ribosomal RNA (18S rRNA, Hs99999901_s1) were purchased from Applied Biosystems. The normalized Ct value of each gene was obtained by subtracting the Ct value for 18S rRNA.
6
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted with Sepasol RNA I Super (Nacalai Tesque, Kyoto, Japan) from lung tissues and with the RNeasy Plus Micro Kit (Qiagen, Valencia, CA) from cells. cDNA was reverse transcribed from total RNA samples using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA). Quantitative RT-PCR was performed using SYBR Premix Ex Taq (Takara Bio, Otsu, Japan) and the CFX96 real-time PCR system (Bio-Rad) according to the manufacturer’s instructions. Primers used in this study were shown in Supplementary Table S1 .
7
Total RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the collected tissues using Sepasol RNA I Super (Nacalai
Tesque, Inc., Kyoto, Japan), according to the manufacturer’s instructions, and dissolved
in TE buffer (10 mM Tris–HCl, pH 8.0, 1 mM ethylenediaminetetraacetic acid). The total
RNA concentration was measured using a NanoDrop Lite spectrophotometer (Thermo Fisher
Scientific). The samples were incubated with RQ1 RNase-free DNase (Promega Co., Madison,
WI, USA) on a programmable thermal controller (PTC-100; MJ Research, Waltham, MA, USA)
according to the manufacturer’s instructions. Total RNA samples were reverse-transcribed
using Rever-Tra Ace (Toyobo Co., Ltd., Osaka, Japan) according to the manufacturer’s
instructions. The obtained complementary DNA (cDNA) samples were stored at −80°C until
use.
Tesque, Inc., Kyoto, Japan), according to the manufacturer’s instructions, and dissolved
in TE buffer (10 mM Tris–HCl, pH 8.0, 1 mM ethylenediaminetetraacetic acid). The total
RNA concentration was measured using a NanoDrop Lite spectrophotometer (Thermo Fisher
Scientific). The samples were incubated with RQ1 RNase-free DNase (Promega Co., Madison,
WI, USA) on a programmable thermal controller (PTC-100; MJ Research, Waltham, MA, USA)
according to the manufacturer’s instructions. Total RNA samples were reverse-transcribed
using Rever-Tra Ace (Toyobo Co., Ltd., Osaka, Japan) according to the manufacturer’s
instructions. The obtained complementary DNA (cDNA) samples were stored at −80°C until
use.
8
Lysophospholipid Receptor Antagonist Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AA, a mixture of AAI and AAII, was purchased from Across Organics (Geel, Belgium). Ki16425, an LPA1, 3 receptor antagonist, was obtained from Cayman Chemical (Ann Arbor, MI, USA). Sepasol RNA I super and polyethylene glycol #400 were obtained from Nakarai tesque (Kyoto, Japan). 1-Heptadecanoyl (17:0) LPC, 1-heptadecenoyl (17:1) lysophosphatidylinositol (LPI), 17:0 lysophosphatidylglycerol (LPG), 17:0 lysophosphatidylethanolamine (LPE), and 17:0 lysophosphatidylserine (LPS) were purchased from Avanti Polar Lipids (Alabaster, AL, USA). 17:0 LPA was prepared from 17:0 LPC using phospholipase D from Streptomyces chromofuscus as described previously [12] (link). Egg yolk phosphatidylcholine (PC), 1-palmitoyl LPC, and 1-palmitoyl LPA as standards for TLC were obtained from Funakoshi Co. (Tokyo, Japan). Alzet™ osmotic pumps were purchased from Durect (Cupertino, CA, USA). Chow (MF) purchased from Oriental Yeast (Tokyo, Japan) had the following components: powders of wheat, defatted soybean, alfalfa, defatted rice, defatted bovine milk, soybean oil, corn, white fish meal, and beer yeast.
9
RNA Extraction and Reverse Transcription
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from each segment of the oviduct (the infundibulum, magnum, isthmus, uterus and vagina), and from the cultured vaginal tissues using Sepasol RNA I Super (Nacalai Tesque Inc., Kyoto, Japan), and dissolved in TE buffer (10 mM Tris, pH 8.0, with 1 mM EDTA). They were mixed with 1U of RQ1 RNase-free DNase (Promega Co., Madison, WI, USA), and incubated in a PTC-100 programmable thermal controller (MJ Research Inc., Waltham, MA, USA) at 37°C for 45 min and 65°C for 10 min. Concentration of RNA in each sample was measured using Gene Quant Pro (Amersham Pharmacia Biotech, Cambridge, UK). The RNA samples were then reverse-transcribed using ReverTra Ace (Toyobo Co. Ltd., Osaka, Japan). The reaction mixture (10 µL) contained 1 µg of total RNA, 1×RT buffer, 1 mM dNTP mixture, 20U RNase inhibitor, 0.5 µg of oligo (dT) 20 primer, and 50U ReverTra Ace. Reverse transcription was performed at 42°C for 30 min, followed by heat inactivation for at 99°C 5 min using the PTC-100.
10
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from ~100 mg liver samples using Sepasol RNA I Super (Nakalai Tesque, Kyoto, Japan). Reverse transcription was performed using a ReverTra Ace qPCR RT kit (TOYOBO, Osaka, Japan), followed by RNaseH treatment (Ribonuclease H; Takara Bio, Otsu, Japan). For quantitative analysis of mRNA expression, a real-time PCR was carried out with total cDNA using KAPA SYBR FAST ABI Prism 2X qPCR Master Mix (Kapa Biosystems, Boston, MA). The oligodeoxynucleotide primers used for amplification were Ifnγ-sense: 5′- CGGCACAGTCATTGAAAGCCTA -3′, Ifnγ-antisense: 5′- GTTGCTGATGGCCTGATTGTC -3′, and β-actin-sense: 5′- CATCCGTAAAGACCTCTATGC -3′, β-actin -antisense: 5 ′- ATGGAGCCACCGATCCACA -3′, and Ifnγ inducible protein 10(γ-IP10)-sense: 5′- CCTATGGCCCTCATTCTCAC -3′, γ-IP10-antisense: 5′- CCTATGGCCCTCATTCTCAC -3′, and socs1-sense: 5′- GTGGTTGTGGAGGGTGAGAT -3′, socs1 -antisense: 5 ′- CCCAGACACAAGCTGCTACA -3′. Amplified products were detected online via intercalation of the fluorescent dye using the StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The fractional cycle number at which the fluorescence passes the threshold (CT values) was used for quantification using a comparative CT method.34 (link) The mRNA expression of the target genes of interest was normalized to the mRNA expression level of β-actin.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!