Total RNA from control and 3-BrPA-treated cells was extracted following a Trizol-based protocol (Thermo Fisher Scientific Inc.-Life Technologies™-Ambion®, Massachusetts, USA). RNA (1 μg) was reverse transcribed using an oligo(dT)12–18 primer and the M-MLV enzyme (Thermo Fisher Scientific Inc.-Life Technologies™-Invitrogen™, Massachusetts, USA). cDNA was amplified by sqPCR, with a Biometra T3000 Thermocycler (Biometra GmbH, Goettingen, Germany), using gene-specific oligonucleotide primers (Additional file 9 : Table S1). PCR fragments were resolved in 2-3 % agarose gels, according to standard procedures. GAPDH served as gene of reference.
Biometra t3000 thermocycler
Manufactured by Analytik Jena
Sourced in Germany
The Biometra T3000 Thermocycler is a laboratory instrument used for the amplification of DNA and RNA samples. The device precisely controls the temperature and duration of each cycle in the thermal cycling process, which is essential for techniques such as Polymerase Chain Reaction (PCR).
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (3 mentions)
Isopropanol, by Merck Group (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Taq dna polymerase and dntps, by Qiagen (2 mentions)
M mlv enzyme, by Thermo Fisher Scientific (1 mentions)
Sybr green supermix, by Bio-Rad (1 mentions)
Cfx connect, by Bio-Rad (1 mentions)
Chloroform, by Merck Group (1 mentions)
Steponeplus, by Thermo Fisher Scientific (1 mentions)
Quantitect reverse transcription kit, by Qiagen (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Ex taq buffer, by Takara Bio (1 mentions)
Mix2seq kit, by Eurofins (1 mentions)
8 protocols using biometra t3000 thermocycler
1
Quantitative PCR Gene Expression Analysis
2
Quantifying EV-A71 VP1 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hybrid hSCARB2+/+/stat-1–/– mouse organs were homogenized in PBS buffer using protease inhibitors. The entire ribonucleic acid (RNA) content was extracted using TRIzol (Life technologies, United States) and chloroform (Merck Millipore). RNA precipitates were obtained using isopropanol (Merck Millipore) and 75% ethanol. For reverse transcription, complementary deoxyribonucleic acid (cDNA) was generated with the high-capacity cDNA RT kit (Life technologies; Biometra T 3000 Thermocycler). For amplifying DNA signals, the SYBR green supermix (Bio-Rad) was used to perform real-time polymerase chain reactions (Bio-Rad CFX connect). The forward and reverse cDNA sequences of primer pairs of GAPDH were as follows: forward: GTTCCTACCCCCAATGTG and reverse: CAACCTGGTCCTCAGTGTAG, and those for EV-A71 VP1 were as follows: forward: CTGGTAAAGGTCCAGCACTC and reverse: GGGAGGTCTATCTCTCCAAC. VP1 gene expression levels were normalized to those of GAPDH.
3
Quantitative RT-PCR for VIC and AV Leaflets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from VIC cultures was isolated with a RNeasy mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. AV leaflets were frozen in liquid nitrogen, crushed using a mortar and pestle, and lysed in TRIZOL (Thermo Fisher Scientific, Waltham, MA, USA) before purifying with a RNeasy mini kit. RNA was reverse transcribed using a commercial kit (Quantitect Reverse Transcription Kit, Qiagen, Hilden, Germany) and Biometra T3000 Thermocycler (Göttingen, Germany). Quantitative RT-PCR was performed using Promega SYBR Green PCR kit (Promega, Madison, WI, USA) on a real-time cycler (Applied Biosystems StepOnePlus; Thermo Fisher Scientific, Waltham, MA, USA). PCR protocol was as follows: starting with an initial step for 2 min at 50 °C, followed by 2 min at 95 °C. In all, 40 cycles were performed for 15 s at 95 °C and 30 s at 60 °C followed by single steps for 15 s at 95 °C, 1 min at 60 °C, and 15 s at 95 °C (primer sequences are shown in Table 1 ). The expression of the RPL-29A gene was used as a reference gene to normalize the results using the comparative 2-ΔΔCt method.
4
Bacterial Stress Response Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For acid shock treatment, late-exponential-phase cultures grown in AB medium were centrifuged (4,000 × g for 5 min) and resuspended in the same volume of fresh AB medium acidified with HCl to pH 2.5, after which 500 μL of the resuspended culture was incubated at 37°C for 1 h while shaking in an orbital shaker (200 rpm). For heat shock treatment, 50 μL of a late-exponential-phase culture was transferred to a sterile PCR tube and incubated in a Biometra T3000 thermocycler (Biometra, Göttingen, Germany) at 52°C for 20 min. Afterwards, untreated (control) and stress-treated cells were serially diluted in LB and subsequently spotted (5 μL) on LB agar. After ca. 24 h of incubation at 37°C, CFU were counted and used to determine the CFU per milliliter of the sample. Inactivation was expressed as logarithmic reduction factor, which was calculated as log10(N0/N), in which N0 and N represent the CFU per milliliter before and after the treatment, respectively.
5
RAPD-PCR Fingerprinting for Isolate Differentiation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Random amplified polymorphic DNA (RAPD)-polymerase chain reaction (PCR) fingerprinting was performed to differentiate the potential isolates into groups. A 25 μL mixture containing 2 mM 10× Ex Taq buffer (Takara Bio Inc., Shiga, Japan), 1 mM MgCl2, 200 μM dNTP, 1 U Ex Taq DNA polymerase, 0.16 μM RAPD primer (p1281, 5′-AACGCGCAAC-3′) [11 (link)], and 10 ng of template DNA was amplified with a program composed of 1 cycle of 94°C for 2 min; 6 cycles of 94°C for 30 s, 36°C for 60 s, and 72°C for 90 s; 30 cycles of 94°C for 20 s, 36°C for 30 s, and 72°C for 90 s; and finally, 1 cycle of 72°C for 3 min (Biometra T3000 thermocycler; Analytik Jena, Göttingen, Germany) [11 (link)]. PCR products were electrophoresed at 50 V for 1 h on a 1.5% (w/v) agarose gel.
6
Rumen Microbiome DNA Extraction and Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rumen samples were immediately frozen in a −80 °C freezer and then freeze-dried. DNA was extracted from 100 mg of homogenized rumen sample through bead beating followed by phenol–chloroform extraction [5 (link)]. The resulting solution was precipitated with ice-cold isopropanol (Sigma-Aldrich, St. Louis, MO, USA) to obtain the DNA pellet. The pellet was washed with 70% ethanol twice and suspended in 200 μL of ddH2O. The DNA was quantified using a Nanodrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA) and stored in a −20 °C freezer until analyzed. For next-generation sequencing (NGS), the 16S ribosomal RNA (rRNA) gene regions were amplified for further analysis. The primer set used in this study was 16S, 515F, and 806R for amplification of the V4 16S rRNA gene region. The PCR reaction was conducted in a PCR machine (Biometra T3000 thermocycler, Analytik Jena, Göttingen, Germany); the PCR conditions are shown in Supplementary Materials Table S1 .
7
Amplification and Sequencing of Antibiotic Resistance Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genes ramR, marR, soxR and rpsJ were amplified and sequenced with the primers described previously [18 (link),21 (link)].
Standard PCR protocols and conditions were used in the following way: initial denaturation at 94 °C for 5 min; 35 cycles of 94 °C for 30 s, 52 °C for 1 min and 72 °C for 1 min; and a final incubation for 5 min at 72 °C. We used Taq DNA polymerase and dNTPs from QIAGEN (Hilden, Germany), and a T3000 Biometra thermocycler (Biometra, Germany).
Sequencing was performed with the Mix2Seq Kit (Eurofins Genomics).
Sequence analysis was performed with Serial Cloner v2.6 and BLAST (Basic Local Alignment Search Tool,https://blast.ncbi.nlm.nih.gov/Blast.cgi ).
Standard PCR protocols and conditions were used in the following way: initial denaturation at 94 °C for 5 min; 35 cycles of 94 °C for 30 s, 52 °C for 1 min and 72 °C for 1 min; and a final incubation for 5 min at 72 °C. We used Taq DNA polymerase and dNTPs from QIAGEN (Hilden, Germany), and a T3000 Biometra thermocycler (Biometra, Germany).
Sequencing was performed with the Mix2Seq Kit (Eurofins Genomics).
Sequence analysis was performed with Serial Cloner v2.6 and BLAST (Basic Local Alignment Search Tool,
8
Plasmid Incompatibility Group Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Identification of replicon types of the 18 major plasmid incompatibility (Inc) groups present in Enterobacteriaceae was performed by multiplex PCR.
Standard PCR protocols and conditions were used in the following way: initial denaturation at 94 °C for 5 min; 30 cycles of 94 °C for 1 min, 60 °C for 30 s and 72 °C for 1 min; and a final incubation for 5 min at 72 °C. We used Taq DNA polymerase and dNTPs from QIAGEN (Hilden, Germany), and a T3000 Biometra thermocycler (Biometra, Gottingen, Germany).
The protocol allows detection of the following Inc groups: Hl1, Hl2, I1-Iγ, X, L/M, N, FIA, FIB, W, Y, P, FIC, A/C, T, FIIs, F, K, B/O [27 (link)].
Standard PCR protocols and conditions were used in the following way: initial denaturation at 94 °C for 5 min; 30 cycles of 94 °C for 1 min, 60 °C for 30 s and 72 °C for 1 min; and a final incubation for 5 min at 72 °C. We used Taq DNA polymerase and dNTPs from QIAGEN (Hilden, Germany), and a T3000 Biometra thermocycler (Biometra, Gottingen, Germany).
The protocol allows detection of the following Inc groups: Hl1, Hl2, I1-Iγ, X, L/M, N, FIA, FIB, W, Y, P, FIC, A/C, T, FIIs, F, K, B/O [27 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!