MtbRNAP, the σB subunit and RbpA were expressed and purified as described before (24 (link)). Mutations in σB and RbpA were introduced using the Agilent Quick Change Lightening Site-directed Mutagenesis Kit, following the manufacturer's protocol. Variants of the sigAP promoter were prepared by annealing two oligonucleotides followed by primer extension and PCR amplification with Pfu using fluorescent primers (Table S1). The amplified promoter DNA fragments were resolved by 8% native PAGE and extracted using the Nucleospin® Gel and PCR Clean-up Kit (Macherey Nagel). The sigAP-TGTG promoter labeled with Cy3 at the +2 position was purified through 6% PAGE after primer extension.
Quickchange lightening site directed mutagenesis kit
Manufactured by Agilent Technologies
The QuickChange Lightening site-directed mutagenesis kit is a laboratory product designed for making site-specific mutations in double-stranded plasmid DNA. It enables rapid and efficient introduction of point mutations, deletions, and insertions into target DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Nucleospin gel and pcr clean up kit, by Macherey-Nagel (1 mentions)
Hek293t, by American Type Culture Collection (1 mentions)
Streptomycin, by Thermo Fisher Scientific (1 mentions)
Penicillin, by Thermo Fisher Scientific (1 mentions)
Hek293t, by Corning (1 mentions)
Tzm bl, by American Type Culture Collection (1 mentions)
Rpmi 1640 medium, by Corning (1 mentions)
Cem ss, by American Type Culture Collection (1 mentions)
Mifepristone, by Merck Group (1 mentions)
Iκbα antibody, by Santa Cruz Biotechnology (1 mentions)
Luciferase reporter assay kit, by Promega (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Nf κb p65, by Santa Cruz Biotechnology (1 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions)
Minimum essential medium (mem), by Thermo Fisher Scientific (1 mentions)
Opti mem, by Thermo Fisher Scientific (1 mentions)
Dbcamp, by Merck Group (1 mentions)
Pd98059, by Bio-Techne (1 mentions)
Ly294002, by Bio-Techne (1 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions)
12 protocols using quickchange lightening site directed mutagenesis kit
1
Preparation of Promoter Variants for Mtb RNAP Study
Check if the same lab product or an alternative is used in the 5 most similar protocols
MtbRNAP, the σB subunit and RbpA were expressed and purified as described before (24 (link)). Mutations in σB and RbpA were introduced using the Agilent Quick Change Lightening Site-directed Mutagenesis Kit, following the manufacturer's protocol. Variants of the sigAP promoter were prepared by annealing two oligonucleotides followed by primer extension and PCR amplification with Pfu using fluorescent primers (Table S1). The amplified promoter DNA fragments were resolved by 8% native PAGE and extracted using the Nucleospin® Gel and PCR Clean-up Kit (Macherey Nagel). The sigAP-TGTG promoter labeled with Cy3 at the +2 position was purified through 6% PAGE after primer extension.
+ Expand
MtbRNAP, the σB subunit and RbpA were expressed and purified as described before (24 (link)). Mutations in σB and RbpA were introduced using the Agilent Quick Change Lightening Site-directed Mutagenesis Kit, following the manufacturer's protocol. Variants of the sigAP promoter were prepared by annealing two oligonucleotides followed by primer extension and PCR amplification with Pfu using fluorescent primers (Table S1). The amplified promoter DNA fragments were resolved by 8% native PAGE and extracted using the Nucleospin® Gel and PCR Clean-up Kit (Macherey Nagel). The sigAP-TGTG promoter labeled with Cy3 at the +2 position was purified through 6% PAGE after primer extension.
2
Site-Directed Mutagenesis of CELF2 3'UTR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Specific protein binding sequences in CELF2 3′UTR constructs (Figures 3D and 3E ) were mutated using QuickChange Lightening Site-Directed Mutagenesis kit (Agilent Technologies) according to manufacturer’s instructions. Sequence specific primers used for mutagenesis are listed in Table S4 .
3
Generating Pseudotyped HIV Viruses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T, TZM-bl, and CEM-SS cell lines were obtained from the American Type Culture Collection. HEK293T and TZM-bl cell lines were maintained in Dulbecco's modified Eagle's medium and CEM-SS cell line was maintained in RPMI 1640 medium (Corning Cellgro). Both media were supplemented to contain 10% fetal calf serum (Hyclone), 100 IU/ml penicillin and 100 μg/ml streptomycin (GIBCO).
A3G-P210R mutant was generated by site-directed mutagenesis (QuickChange Lightening site-directed mutagenesis kit, Agilent Technologies) using the following primers: P210R_sense: 5’ATTCACTTTCAACTTTAACAATGAACGGTGGGTCAGAGGAC3’ P210R_antisense: 5’GTCCTCTGACCCACCGTTCATTGTTAAAGTTGAAAGTGAAT3’.
All viruses were prepared using a previously described HIV-1 vector pHDV-eGFP pseudotyped by co-transfecting with phCMV-G plasmid, which expresses vesicular stomatitis virus glycoprotein (VSV-G) [42 (link), 53 (link)–58 (link)]. Briefly, we co-transfected pHDV-eGFP (1.0 μg), pHCMV-G (0.25 μg), and either 0.34 μg or 0.67 μg of pFlag-WT-A3G or pFlag-P210R-A3G expression plasmids in the presence or absence of pcDNA-hVif using polyethylenimine (PEI) as previously described [42 (link), 53 (link)–55 (link)]. Virus-containing supernatant was clarified by filtering through a 0.45-μm filter and kept at -80°C until use.
A3G-P210R mutant was generated by site-directed mutagenesis (QuickChange Lightening site-directed mutagenesis kit, Agilent Technologies) using the following primers: P210R_sense: 5’ATTCACTTTCAACTTTAACAATGAACGGTGGGTCAGAGGAC3’ P210R_antisense: 5’GTCCTCTGACCCACCGTTCATTGTTAAAGTTGAAAGTGAAT3’.
All viruses were prepared using a previously described HIV-1 vector pHDV-eGFP pseudotyped by co-transfecting with phCMV-G plasmid, which expresses vesicular stomatitis virus glycoprotein (VSV-G) [42 (link), 53 (link)–58 (link)]. Briefly, we co-transfected pHDV-eGFP (1.0 μg), pHCMV-G (0.25 μg), and either 0.34 μg or 0.67 μg of pFlag-WT-A3G or pFlag-P210R-A3G expression plasmids in the presence or absence of pcDNA-hVif using polyethylenimine (PEI) as previously described [42 (link), 53 (link)–55 (link)]. Virus-containing supernatant was clarified by filtering through a 0.45-μm filter and kept at -80°C until use.
4
Gene Expression Modulation Protocols
5
Lentiviral Vector Production and Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Expression plasmids of Flag-A3G, HIV-1 Vif and its N-terminal double-alanine substitution mutants, HIV-1 vector HDV-eGFP, and VSV-G expression plasmid phCMV-G were previously described [19 (link), 25 (link)–31 (link)]. All Vif mutants were generated by site-directed mutagenesis using a QuickChange Lightening site-directed mutagenesis kit (Agilent Technologies) and verified by sequencing. The Flag-CBFβ expression plasmid was obtained from Addgene.
HeLa-derived reporter TZM-bl and 293T cell lines were maintained in DMEM (Corning Cellgro) supplemented with 10% fetal bovine serum (HyClone) and 1% penicillin–streptomycin (GIBCO).
HeLa-derived reporter TZM-bl and 293T cell lines were maintained in DMEM (Corning Cellgro) supplemented with 10% fetal bovine serum (HyClone) and 1% penicillin–streptomycin (GIBCO).
6
Sema3C Isoform Generation and Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sema3C cDNA (NCBI DQ890847) vector from Genomic and Proteomics Core Facility of German Cancer Research Center was shuttled into pAD/CMV/V5 and pLenti6.2/V5-DEST (Invitrogen) by Gateway cloning for virus production. Sema3CΔ13 and Sema3Cp60 isoforms were generated using the QuickChange Lightening Site-Directed Mutagenesis Kit (Agilent Technologies) to introduce stop codons. PCR primers for the Sema3CΔ13 isoform: (5′-CAAGTTAAAGGCCCTCATCAATAGTTAGTAAAGTAGAAACAGGAGGAATCAGTT-3′), (5′-AACTGATTCCTCCTGTTTCTACTTTACTAACTATTGATGAGGGCCTTTAACTTG-3′); and for Sema3Cp60: (5′-GAAACGGAGGAGCCGAAGATAATAGGTGAGACATGGAAACCCAC-3′) and (5′-GTGGGTTTCCATGTCTCACCTATTATCTTCGGCTCCTCCGTTTC-3′). The translated protein sequences are shown in Fig 1A . Control siRNA (AM4636) and siRNA against human plexinD1 (AM16708, clone ID: 108678) were from LifeTechnologies. Transfection of HUVEC (1.2 × 105 cells) with siRNA duplexes (final concentration, 200 pmol) was performed with Oligofectamine according to the transfection protocol (Invitrogen). shRNA against Nrp-1 (clone ID: 16466, 333723) and Nrp-2 (clone ID: 346687, 176015) were from Thermo Scientific. shRNA against PlexinA2 (clone ID: 389145, 389146) was from Dharmacon.
7
Site-Directed Mutagenesis of CELF2 3'UTR
8
NF-κB Binding Site SNP Reporter Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
NF-κB binding site SNP rs9395890 reporter (from 53820675 to 53821295, 620 bp) was amplified by polymerase chain reaction from one home-made genomic DNA library with the primer pair: 5′: 5′-GGGGTACCGCATCTACGTTCTTAAATGGCC-3′ and 3′: 5′-GGAAGATCTCCTACAGAACCATTACACTCTC-3′ and subcloned into a pGL3 basal reporter (Promega, USA) cut at KpnI and BglII sites. After the sequence verification, we further changed the current T allele into G allele using the QuickChange Lightening Site-directed mutagenesis kit (Agilent Technology). HEK293 cells were grown in Dulbecco’s modified Eagle’s medium supplemented with 10% charcoal/dextran-treated fetal bovine serum. The cells in each well (24-well plate) were transfected with total 1 μg DNA and jetPEI (PolyPlus-transfection, Illkirch, France) according to the manufacturer’s protocol. Luciferase activity was assessed after 24 h post transfection using the Promega Luciferase Assay kit and expressed as mean relative light units (RLU) of two transfected sets. Results shown are representative of at least three independent experiments.
9
PRRSV vOTU Domain Mutagenesis
10
Characterization of HCV E1E2 Mutants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We observed the two plasmids (1b-1-2 and 1b-1-3) coding for E1E2 sequence differed at amino acid positions 292 in the E1, 388 and 395 in the HVR1 domain. We generated six mutant strains of 1b-1-2 with a mutation for 1b-1-2I388V , 1b-1-2V395A , T292A 1b-1-2I388V , T292A 1b-1-2V395A , 1b-1-2DM and T292A 1b-1-2 DM (DM corresponds to double mutant I389V and V396A) using primers enlisted in Table 1 (QuickChange Lightening Site Directed mutagenesis kit, Agilent Tech). HCVpp were then generated from two wild type 1b-1-2, 1b-1-3 and six mutants and infectivity assays were conducted following Bartosch et al. (2003) protocol [27 (link)].
Infectivity assays were done in quadruplet with three technical replicate each.
Infectivity assays were done in quadruplet with three technical replicate each.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!