Expand high fidelity dna polymerase

The length of FLO11p was measured from the amplification of FLO11 alleles with the primers FLO11 (Flo11IntFw CTCCCTCATCATGTTGTGGTTC), and (Flo11IntRv AACGACGGTGGTTGAGACAA) according to Legras et al. (2014) (link). The PCR reaction was performed with Expand High Fidelity DNA polymerase (Roche) to amplify this long DNA fragment. The PCR program: 94°C for 2 min, followed by 10 cycles: 94°C for 15 s, 61°C for 30 s, 68°C for 5 min and 20 cycles at 94°C for 15 s, 61°C for 30 s, and 68°C for 5 min + a 5 s cycle prolongation for each successive cycle. The PCR products were subjected to electrophoresis for 1 h at 100 V in 0.7% agarose gels which were then stained with ethidium bromide (14 mg/ml) for visualization of the DNA bands under UV light. Fragment sizes were estimated by comparison with DNA size markers (GeneRuler 1 Kb DNA Ladder, Thermo Fisher Scientific, Inc., Waltham, MA, United States), with Quantity One 4.6.5 software from Bio-Rad.
The FLO11 promoter deletion was performed with the primer pair Flo11promFw CAGCCCCAGAGTATGTTCTCACAG and Flo11promRv AATCACCTTCTAAACGCTCGGA. This PCR was performed with Taq polymerase (Promega Corp., Madison, WI, United States). The PCR program was 95°C for 5 min, followed by 30 cycles of 95°C for 30 s, 56°C for 45 s, and 72°C for 1 min. The presence of the deletion was detected by capillary electrophoresis on a MultiNA MCE 202 (Shimadzu, France).

Viral RNA was prepared following standard procedures to determine the consensus sequence (from nucleotide 250 to nucleotide 4180). RNAs were used for cDNA synthesis with the avian myeloblastosis virus reverse transcriptase (Promega), followed by PCR amplification using Expand high-fidelity DNA polymerase (Roche). PCR products were column purified (Qiagen) and subjected to standard Sanger sequencing. The oligonucleotide primers used for sequencing have been previously described^{33 (link),34 (link)}. Sequences were aligned with Clustal W. Mutations relative to the sequence of the cDNA of bacteriophage Qβ cloned in the plasmid pBR322^{31 (link),32 (link)} were identified using BioEdit.

The full-length phactr3 cDNA (NP_001186435, 518 aa) was obtained by RT-PCR using an RT primer 5′-AATCTCTATGGCCTGTGGAA-3′, a reverse primer 5′-TCTCTATGGCCTGTGGAATCT-3′, a forward primer 5′-CTGGATGAGATGGACCAAACG-3′, a template poly A⁺ RNA of HL-60 cells, and a high fidelity RNA PCR kit (Takara, Japan). It was subcloned into the SmaI site in pKF18k (Takara, Japan). pEGFP-c2-phactr3 was produced by inserting the BamHI/EcoRI fragment of pKF18k-phactr3 into BglII/EcoRI sites of pEGFP-c2 (Clontech) [10] (link). A mutant with a deleted N-terminal region (ΔNt) (Fig. 1C) was generated by PCR-based mutagenesis using a reverse primer 5′-CATCTCATCCAGGGGGATCT-3′ and a forward primer 5′-GCGCTGGAGAAGAAGATGGC-3′. Expand High-Fidelity DNA polymerase (Roche Molecular Biochemicals) was used for the PCR analysis. Deletion mutants of Nt, PP1-binding domain (ΔPP1), ΔRx3/ΔPP1, and NtR (Fig. 1C) were generated by introducing stop codon sequences to terminate protein synthesis at targeted positions using the QuikChange XL site-directed mutagenesis kit (Agilent Technologies). Primers were designed according to the cDNA sequence data of phactr3 (AB098521). The mutations in pEGFP-c2-phactr3 were confirmed by sequencing. Alanine substitution mutants of N1–12 were also generated using the QuikChange XL site-directed mutagenesis kit.