PCR fragments that were to be ligated to bead-immobilised DNA, required cohesive ends. For the assembly set out in Figure 2C , a 5′-overhang in PCR product ‘frag1’ (Supplementary Table S4 ) was introduced by restriction with BspQI: a 30 μl reaction consisting of 150 pM DNA, 1× buffer 3.1 (NEB) and 30 units of BspQI (NEB), was incubated at 50°C for 2 h, followed by inactivation of the restriction enzyme by heating to 80°C for 20 min. 5′-Overhangs in fragT10 PCR fragments for the final fragment ligation in the ZIgE SpliMLiB library (Figure 3C , step viii) were introduced by restriction with Esp3I, in 50 μl reactions consisting of 70–100 pM of purified PCR fragment, 50 units of Esp3I (ThermoFisher Scientific), 1× buffer Tango (ThermoFisher Scientific) supplemented with 1 mM DTT. The restriction reactions were incubated at 37°C for 2 h followed by 20 min at 65°C to heat-inactivate Esp3I. In both cases, the restricted DNA was purified using the SPRI bead protocol described above.
Bspqi
Manufactured by New England Biolabs
Sourced in United States
BspQI is a type II restriction endonuclease that recognizes and cleaves the DNA sequence 5'-GCTCTTC-3'.
Automatically generated - may contain errors
Lab products found in correlation
T4 ligase, by New England Biolabs (3 mentions)
Purelink quick gel extraction kit, by Thermo Fisher Scientific (2 mentions)
X tremegene 9 transfection reagent, by Roche (2 mentions)
Genejet plasmid miniprep kit, by Thermo Fisher Scientific (1 mentions)
Bovine serum albumin (bsa), by New England Biolabs (1 mentions)
Na2seo3, by Thermo Fisher Scientific (1 mentions)
Nadph, by Abcam (1 mentions)
Coomassie plus bradford reagent, by Thermo Fisher Scientific (1 mentions)
Pcr cleanup kit, by Thermo Fisher Scientific (1 mentions)
Q5 high fidelity polymerase, by New England Biolabs (1 mentions)
E coli bl21 de3, by New England Biolabs (1 mentions)
Dntps, by New England Biolabs (1 mentions)
Ethylenediaminetetraacetic acid edta, by Avantor (1 mentions)
Isopropylβ d 1 thiogalactopyranoside iptg, by IBI Scientific (1 mentions)
Chloroquine cq, by Merck Group (1 mentions)
Esp3i, by Thermo Fisher Scientific (1 mentions)
Bsrdi, by New England Biolabs (1 mentions)
Maxiprep kit, by Qiagen (1 mentions)
Pac sgrna cas9, by Addgene (1 mentions)
Pcr purification kit, by Qiagen (1 mentions)
19 protocols using bspqi
1
Introducing Cohesive Ends for DNA Ligation
2
Phage Display Kit Protocol
3
Transfection of HBV Genome Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For transfections, a full-length linear HBV DNA (nt 1820-1820) with sticky ends was used.
As previously described, linear HBV monomers were excised from the plasmids by restriction enzyme digestion with 5 U of BspQI (New England Biolabs, Beverly, MA, USA) at 50 °C. The 3.2 kb fragments were gel purified with PureLink Quick Gel Extraction Kit (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions and the DNA was quantified spectrophotometrically [20 (link)].
For transfections, cells were seeded in 6 or 24 well plates and grown to 60–70% confluence. Transfections were carried out using X-tremeGene 9 transfection reagent (Roche, Mannheim, Germany), according to the manufacturer’s recommendations. Transfection with a linear full-length HBV genome derivative from the pCH-9/3091 POL minus plasmid was used as control for evaluating the amount of remaining input DNA. For trans-complementation assays, cells were co-transfected with sgtF1b X(-) or sgtF4 X(-) genomes and sgtF1b HBx or sgtF4 HBx expression plasmids, respectively. Cells were maintained at 37 °C in 5% CO2 atmosphere. After 6 h incubation, medium was replaced, and cultures were incubated for 72 or 96 h. In order to eliminate HBV DNA input, cell culture medium was collected every 24 h, cells were washed six times with PBS, and fresh medium was added.
As previously described, linear HBV monomers were excised from the plasmids by restriction enzyme digestion with 5 U of BspQI (New England Biolabs, Beverly, MA, USA) at 50 °C. The 3.2 kb fragments were gel purified with PureLink Quick Gel Extraction Kit (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions and the DNA was quantified spectrophotometrically [20 (link)].
For transfections, cells were seeded in 6 or 24 well plates and grown to 60–70% confluence. Transfections were carried out using X-tremeGene 9 transfection reagent (Roche, Mannheim, Germany), according to the manufacturer’s recommendations. Transfection with a linear full-length HBV genome derivative from the pCH-9/3091 POL minus plasmid was used as control for evaluating the amount of remaining input DNA. For trans-complementation assays, cells were co-transfected with sgtF1b X(-) or sgtF4 X(-) genomes and sgtF1b HBx or sgtF4 HBx expression plasmids, respectively. Cells were maintained at 37 °C in 5% CO2 atmosphere. After 6 h incubation, medium was replaced, and cultures were incubated for 72 or 96 h. In order to eliminate HBV DNA input, cell culture medium was collected every 24 h, cells were washed six times with PBS, and fresh medium was added.
4
Bacterial Strain Cultivation and Antibiotic Use
5
Simulating HBV Genome Variability
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to simulate viral variability, a mix of 10 to 20 clones (pUC19-full-length HBV genomes) of each viral variant was used in each experiment.
As previously described, full-length linear HBV genomes were excised from the plasmid by restriction enzyme digestion with 5 U of BspQI (New England Biolabs, USA) at 50°C [27 ]. The 3.2-kb fragments were gel purified with PureLink Quick Gel Extraction Kit (Invitrogen, USA), according to the manufacturer’s instructions and the DNA was quantified spectrophotometrically.
For transfections, cells were seeded in 24 or 6 well plates and grown to 60–70% confluence. Transfections were carried out using X-tremeGene 9 transfection reagent (Roche, Germany), according to the manufacturer’s recommendations. Empty vector pUC19 was used as control. Cells were maintained at 37°C in 5% CO2 atmosphere. After 6 h incubation, medium was replaced, and cultures were incubated for 48 h. Cells were treated with 100 μM chloroquine (CQ; Sigma, USA) when indicated.
As previously described, full-length linear HBV genomes were excised from the plasmid by restriction enzyme digestion with 5 U of BspQI (New England Biolabs, USA) at 50°C [27 ]. The 3.2-kb fragments were gel purified with PureLink Quick Gel Extraction Kit (Invitrogen, USA), according to the manufacturer’s instructions and the DNA was quantified spectrophotometrically.
For transfections, cells were seeded in 24 or 6 well plates and grown to 60–70% confluence. Transfections were carried out using X-tremeGene 9 transfection reagent (Roche, Germany), according to the manufacturer’s recommendations. Empty vector pUC19 was used as control. Cells were maintained at 37°C in 5% CO2 atmosphere. After 6 h incubation, medium was replaced, and cultures were incubated for 48 h. Cells were treated with 100 μM chloroquine (CQ; Sigma, USA) when indicated.
6
CRISPR/Cas9 Knockout of OSNAC15 in Rice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The osnac15 knockout lines were generated in the cv Nipponbare using the VK005-01 vector and performed according to the instructions (Viewsolid, Beijing, China). Briefly, a 20 bp gRNA target sequence (5′-GTCGGTGATCAACCAGCTGG-3′) was designed using the CRISPR-P 2.0 (http://crispr.hzau.edu.cn/CRISPR2/ , accessed on 15 May 2021) and specificity detection was conducted using a BLAST search against the rice genome. Two designed target sequences were synthesized and formed the oligoduplex in a 25 µL reaction at 95 °C for 3 min. Then, the oligoduplex was cloned into the linearized vector with BspQI (New England Biolabs (Beijing), Beijing, China) to generate the CRISPR/Cas9 plasmid. The plasmid was transformed into Nipponbare with the Agrobacterium strain EHA105 (Biomed, Beijing, China). To detect the homozygous mutants, genomic DNA was extracted from leaves of transgenic seedlings, and PCR-amplified products were sequenced by the primer (GATGAAGTGGACGGAAGGAAGGAG). The target sequences and PCR amplified primers are shown in Table S1 .
7
Plasmid DNA Digestion and Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmid DNA templates were digested
with BspQI and BsrDI from New England Biolabs (Ipswich, MA) to yield
three DNA fragments: two high-molecular-weight fragments and one lower-molecular-weight
fragment containing the poly(A) sequence. These sizes of the poly(A)
containing fragments were determined by capillary electrophoresis
using Agilent’s D1000 TapeStation kit and the standard ladder
as described by the vendor’s protocol (CA).
with BspQI and BsrDI from New England Biolabs (Ipswich, MA) to yield
three DNA fragments: two high-molecular-weight fragments and one lower-molecular-weight
fragment containing the poly(A) sequence. These sizes of the poly(A)
containing fragments were determined by capillary electrophoresis
using Agilent’s D1000 TapeStation kit and the standard ladder
as described by the vendor’s protocol (CA).
8
Molecular Cloning of oatA and cysB Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All plasmids used in this work are listed in Table 2 . Primers were synthesized by Integrated DNA Technologies, Inc. (IDT [Coralville, IA, United States]) and are listed in Table 3 . Genes were amplified from S. enterica genomic DNA using Pfu Ultra II fusion DNA polymerase (Stratagene) per manufactures instructions. A high efficiency cloning method described elsewhere (Galloway et al., 2013 (link); VanDrisse and Escalante-Semerena, 2016 (link)) was used to clone oatA and cysB genes into pCV3 (complementation vector, L -(+)-arabinose inducible) and pTEV16 or pTEV18 (overexpression vectors, IPTG inducible). Restriction enzyme BspQI was purchased from New England Biolabs. The resulting complementation vector was referred to as pOatA6. The resulting overexpression vectors were referred to as pOatA4 and pCysB2 (full length CysB).
9
CRISPR Library Preparation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 20 nt guide RNA target sites were appended with common adaptor sequences and had the first nucleotide substituted for a G, to improve transcription from the U6:2 promoter. The final sequence was of the format shown in Fig. 2 C. Oligonucleotide synthesis for the 68,340 sgRNA sequences was performed by CustomArray Inc, USA, and the assembled oligonucleotide pool was amplified using Phusion polymerase (NEB, UK) and oligonucleotides LibAmpF and LibAmpR (Table S1 ) with the following thermal cycling parameters (98°C 30 s, 30 cycles of (98°C 15 s, 55°C, 30 s, 72°C 30 s), 72°C 5 min). PCR products were purified using a PCR purification kit (Qiagen, UK), digested with BspQ I (NEB), and 20 nt fragments were extracted from a 20% acrylamide-TBE gel (Life Technologies, UK). Gel extraction was performed by homogenising gel pieces and overnight incubated in 600 μL 0.3 mol/L NaCl. DNA was purified by ethanol precipitation and cloned into pAc-sgRNA-Cas9 (Addgene, #49330, USA) also cut with BspQ I. Approximately 7 × 106 transformants were obtained, corresponding to at least 100-fold coverage of the initial library. Colonies were scraped from bacterial plates and DNA was extracted using a maxiprep kit (Qiagen).
10
Linearization of Plasmid DNA Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Prior to RNA IVTs, pDNAs encoding firefly luciferase (pTLuc), spike 2p SARS-CoV-2 (pTCOV01), and green fluorescent protein (pTGFP) were linearized using BspQI (NEB) enzyme, according to the manufacturer’s instructions.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!