Total RNA was extracted from 5 × 106 to 5 × 107 cells using the RaPure Total RNA Mini Kit (Magen, #R4011-02), treated with DNAseI to eliminate genomic DNA, and quantitated using the Epoch spectrophotometer. Reverse transcription (RT) followed instructions provided by StarScript II First-strand cDNA Synthesis Kit-II (GenStar, #A214-05). The resulting cDNA was used as a template for the amplification of target gene transcripts by RT-PCR, using HieffTM qPCR SYBR® Green Master Mix (YEASEN, #11201ES08) on the Hema9600 PCR machine. After 35 amplification cycles, reaction products were analyzed and β-actin RNA was used as a loading control. The primer sequences were as follows: survivin forward: CCGACGTTGCCCCCTGC; survivin reverse: TCGATGGCACGGCGCAC; β-actin forward: AAATCGTGCGTGACATTAAGC; β-actin reverse: CCGATCCACACGGAGTACTT (15 (link), 16 (link)).
Rapure total rna mini kit
Manufactured by Magen Biotechnology Co
The RaPure Total RNA Mini Kit is a laboratory equipment designed for the rapid and efficient extraction of total RNA from various biological samples. The kit utilizes a silica-based membrane technology to provide high-quality, pure RNA suitable for downstream applications such as RT-qPCR, Northern blotting, and microarray analysis.
Automatically generated - may contain errors
Lab products found in correlation
Real time pcr detection system, by Agilent Technologies (6 mentions)
Sybr green realtime pcr master mix, by Toyobo (3 mentions)
Qpcr rt master mix kit, by Toyobo (3 mentions)
Hieff qpcr sybr green master mix, by Yeasen (1 mentions)
Starscript 2 first strand cdna synthesis kit 2, by GenStar (1 mentions)
7 protocols using rapure total rna mini kit
1
Quantitative Analysis of Survivin Expression
2
Quantifying Colonic Mucosa Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNAs were extracted from the biopsy tissue of colonic mucosa using the RaPure Total RNA Mini Kit (Magen, CN) according to the manufacturer’s instructions. Total RNA reverse transcription to cDNA was performed with the All-in-One First-Strand Synthesis Master Mix (with dsDNase) (BioMed, CN). RT-qPCR was performed using the Real-time PCR Detection System (Agilent Technologies, USA) with the Taq SYBR® Green qPCR Premix (BioMed, CN). The relative abundance of mRNA was using GAPDH as an internal control gene. The primers were provided in Supplement Table 1 .
3
Quantitative RT-PCR for HBx Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RaPure Total RNA Mini Kit (Magen, R4011, CN) was used to extract the total RNA from the cells or tissues, and the All-in-One First-Strand Synthesis MasterMix (with dsDNase) (BioMed, BM60501S, CN) was used to reverse the process into cDNA. The Taq SYBR® Green qPCR Premix (BioMed, BM60304S, CN) and Real-time PCR Detection System (Agilent Technologies, US) were used to perform a real-time quantitative polymerase chain reaction (qRT PCR). The experiments were performed in triplicate and repeated three times. The primers were provided as follows:
HBx-F: GCGCGGGACGTCCTTTGTCT;
HBx-R: GTCGGCCGGAACGGCAGATG;
GAPDH-F: GGAGCGAGATCCCTCCAAAAT;
GAPDH-R: GGCTGTTGTCATACTTCTCATGG.
HBx-F: GCGCGGGACGTCCTTTGTCT;
HBx-R: GTCGGCCGGAACGGCAGATG;
GAPDH-F: GGAGCGAGATCCCTCCAAAAT;
GAPDH-R: GGCTGTTGTCATACTTCTCATGG.
4
Quantitative RT-PCR Protocol for Tissue RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted using the RaPure Total RNA Mini Kit (Magen, CN) according to the manufacturer’s instructions. The reverse transcription of total RNA to cDNA was performed with qPCR RT Master Mix kit (TOYOBO, JAN). The qRT-PCR was performed using the Real-time PCR Detection System (Agilent Technologies, US) with the SYBR Green Real-time PCR Master Mix (TOYOBO, JAN). The primers used in this study are provided in Supplementary Table S2 , using ß-actin as internal control gene for rat tissue and LX2. The experiments were performed and repeated 3 times.
5
Quantifying ST6GAL1 Expression in Rat Liver
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted from the biopsy tissue of rat liver using the RaPure Total RNA Mini Kit (Magen, R4011, CN) according to the manufacturer’s instructions. Total RNA reverse transcription to cDNA was performed with the All-in-One First-Strand Synthesis MasterMix (with dsDNase) (BioMed, BM60501S, CN). Real-time quantitative polymerase chain reaction (RT-qPCR) was performed using the Real-time PCR Detection System (Agilent Technologies, US) with the Taq SYBR® Green qPCR Premix (BioMed, BM60304S, CN). The primers were provided as follows:
ST6GAL1-F: AAGGACAGTTTGTACACCGA;
ST6GAL1-R: CTGATACCACTTTGGGATATCTG;
GAPDH-F: AGACAGCCGCATCTTCTTGT;
GAPDH-R: CTTGCCGTGGGTAGAGTCAT.
ST6GAL1-F: AAGGACAGTTTGTACACCGA;
ST6GAL1-R: CTGATACCACTTTGGGATATCTG;
GAPDH-F: AGACAGCCGCATCTTCTTGT;
GAPDH-R: CTTGCCGTGGGTAGAGTCAT.
6
Quantifying KXYA Treatment Effects
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 5 × 105 HepAD38 cells were seeded in 6-well plates. After being incubated for 24 h, the cells were treated with KXYA (500 μg/ml) for 48 h. Total RNAs were extracted using the RaPure Total RNA Mini Kit (Magen, CN) according to the manufacturer’s instructions. The reverse transcription of total RNA to cDNA was performed with a qPCR RT Master Mix kit (TOYOBO, JAN). The quantitative Real-time PCR (qRT-PCR) was performed using the Real-time PCR Detection System (Agilent Technologies, United States) with the SYBR Green Real-time PCR Master Mix (TOYOBO, JAN). The primers used in this study are provided in Supplementary Table S3 , using GAPDH as an internal control gene. The experiments were performed in triplicate and repeated 3 times.
7
TGYP Modulates Gene Expression in LO2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 5 × 105 LO2 cells were seeded in 6-well plates. After incubated for 24 h, the cells were treated with TGYP (500 μg/ml) for 48 h. Total RNAs were extracted using the RaPure Total RNA Mini Kit (Magen, CN) according the manufacturer’s instructions. The reverse transcription of total RNA to cDNA was performed with qPCR RT Master Mix kit (TOYOBO, JAN). RT-qPCR was performed using the Real-time PCR Detection System (Agilent Technologies, US) with the SYBR Green Real-time PCR Master Mix (TOYOBO, JAN). The primers used in this study are provided in Supplementary Table S5 , using GAPDH as internal control gene. The experiments were performed in triplicate and repeated 3 times.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!