Total RNAs were extracted by using TRI reagent (Molecular Research Center, Inc.). RNAs were reverse transcribed by using EasyScript Reverse Transcriptase (Transgen Biotech). Then, cDNA was amplified by PCR or qPCR with the primers listed in Supplementary Table 3 . qPCR was performed with SYBR TOPreal qPCR 2× preMIX (Enzynomics) to determine transcript abundance. Transcript quantity was calculated by using the ∆∆Ct method, and Hprt or HPRT1 levels were used as housekeeping controls.
Sybr topreal qpcr 2 premix
Manufactured by Enzynomics
Sourced in United States
SYBR TOPreal qPCR 2× preMIX is a ready-to-use solution for real-time quantitative PCR (qPCR) analysis. It contains all the necessary components, including a DNA polymerase, SYBR Green I dye, and optimized buffer, to perform qPCR reactions.
Automatically generated - may contain errors
Lab products found in correlation
Easyscript reverse transcriptase, by Transgene (2 mentions)
Tri reagent, by Molecular Research Center (1 mentions)
Steponeplus system, by Thermo Fisher Scientific (1 mentions)
Tri reagent, by Thermo Fisher Scientific (1 mentions)
Favorprep tri rna reagent, by Favorgen Biotech (1 mentions)
Revertra ace qpcr rt master mix, by Toyobo (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Cfx96 real time system, by Bio-Rad (1 mentions)
4 protocols using sybr topreal qpcr 2 premix
1
Quantitative RNA Expression Analysis
2
Quantitative Transcriptome Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRI Reagent (Invitrogen) and then reverse transcribed using EasyScript Reverse Transcriptase (Transgen Biotech, Beijing, CN). The resulting cDNA was amplified and qRT-PCR was performed using SYBR TOPreal qPCR 2× PreMIX (Enzynomics, Daejeon, KR) using the StepOnePlus system (Applied Biosystems, Foster city, CA, US). All procedures were performed according to the manufacturer’s instructions. cDNA sample analyses were performed in triplicate.
3
Gene Expression Analysis of Inflammatory Cytokines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted using FavorprepTM Tri-RNA reagent (Favorgen), and cDNA was synthesized using ReverTra Ace® qPCR RT Master Mix (Toyobo) according to the manufacturer's instructions. Quantitative RT-PCR was performed with SYBR TOPrealTM qPCR 2× PreMIX (Enzynomics). Gene expression data were normalized with GAPDH, and primer sequences used in this study are as follows: GAPDH Fwd, CCTGCACCACCAACTGCTTA; GAPDH Rev, GGCCATCCACAGTCTTCTGAG; IL1A Fwd, AGTGCTGCTGAAGGAGATGCCTGA; IL1A Rev, CCCCTGCCAAGCACACCCAGTA; IL6 Fwd, CACTGGCAGAAAACAACCTGAA; IL6 Rev, ACCAGGCAAGTCTCCTCATTGA.
4
Quantifying Expression Levels of IP3R in Drosophila
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from ten 3-day-old male fly bodies with TRIzol (Invitrogen), and RNA samples were reverse-transcribed by M-MLV reverse transcriptase (Primega). Relative quantification PCR was carried out using a SYBR TOPrealTM qPCR 2× PreMIX (Enzynomics), and a CFX96TM Real-Time System (BIO-RAD). Rp49 and Actin 5 C were used as internal controls, and gene expression levels were normalized to the controls. Following primers were used: Rp49 (F 5′-AGCTTCAAGATGACCATCCG-3′, and R 5′-CCAGGAACTTCTTGAATCCG-3′), Actin 5 C (F 5′-TGTGACGAAGAAGTTGCTGC-3′, and R 5′-TCATCACCCACGTACGAGTC-3′), and IP3R (F 5′-GCGGCTTGGGATTACTAGGCCTG-3′, and R 5′-CATCATCCGACCCGGCGTCC-3′). For the data quantification, measurements were conducted in triplicates.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!