Anchored oligo dt 20 primer

Cells were collected, and total RNA was isolated using TRIzol (ThermoFisher Scientific, Inc.) and conventional Phenol/chloroform/isoamyl alcohol extraction method (in ratio 25:24:1, respectively) (Toni et al., 2018 (link)). The RNA samples were treated with Turbo DNA-free Kit (Invitrogen) to eliminate any residual DNA from the preparation. Total RNA (2 μg) was reverse transcribed using the M-MLV reverse transcriptase (PROMEGA) and 0.25 μg of Anchored Oligo(dT)20 Primer (Invitrogen; 12,577–011). We performed qPCR reactions using KAPA SYBR FAST qPCR Master Mix (2X) Kit (Kapa Biosciences) with primer concentrations of 0.4 μM. The primers used in the reactions are listed in Supplementary Table 1. Cycling conditions were as follows: initial denaturation at 95°C for 3 min, then 40 cycles with 95°C for 5 s (denaturation) and 60°C for 20 s (annealing/extension). The melting curve indicates no amplification of unspecific products. The expression of each gene was relative to the PPIB gene (cyclophilin).

We isolated RNA from cells using TRIzol (ThermoFisher Scientific, Inc.) followed by chloroform and isopropanol extraction. The RNA samples were treated with Turbo DNA-free Kit (Invitrogen) to eliminate any residual DNA from the preparation. Total RNA (2 μg) was reverse transcribed using the M-MLV reverse transcriptase (PROMEGA) and 0.25 μg of Anchored Oligo(dT)20 Primer (Invitrogen; 12,577–011). We performed qPCR reactions in triplicate using KAPA SYBR FAST qPCR Master Mix (2X) Kit (Kapa Biosciences) and primer concentrations of 0.4 μM (Additional file 10: Table S1). Cycling conditions were as follows: initial denaturation at 95 °C for 3 min, then 40 cycles with 95 °C for 5 s (denaturation) and 60 °C for 20 s (annealing/extension). To control specificity of the amplified product, a melting-curve analysis was carried out. No amplification of unspecific product was observed. Expression of each gene was relative to Polr2a gene (RNA pol II) and plotted as fold change compared to control in each case.

Total RNA was extracted from cells with TRIzol reagent (Thermo Fisher Scientific) according to the manufacturer's instructions. RNA was treated with Turbo DNase (Invitrogen Ambion, Thermo Fisher Scientific) to eliminate any residual DNA from the preparation. Total RNA (1 μg) was reverse‐transcribed using the Maloney murine leukemia virus reverse transcriptase (Invitrogen) and 0.25 μg of Anchored Oligo(dT) 20 Primer (Invitrogen; 12577‐011). To control specificity of the amplified product, a melting curve analysis was carried out. No amplification of unspecific product was observed. Amplification of cyclophilin B (Ppib) was carried out for each sample as an endogenous control. Primer sequences were forward, 5′ GATCTCCTCCGCAGTCTGG 3′, and reverse, 5′ ACACAATGGGTATCCGGTCT 3′, for mouse Sall2 E1A; forward, 5′AACGGAGACCCCAACAGTTA 3′, and reverse, 5′ TGGGTCAGTGCAACATGAGT 3′, for mouse Sall2E1; forward, 5′ GTGCTGGGAATGCAAGCCATATCT 3′, and reverse, 5′ AAGCGGCTGGAAATGGCTTAGT 3′, for Ccne1; forward, 5′ AGGAAGCGGTCCAGGTAGTT 3′, and reverse, 5′ AGTGCGTGCAGAAGGAGATT 3′, for Ccnd1; forward, 5′ TTGTGGCCTTAGCTACAGGA 3′, and reverse, 5′ GCTCACCGTAGATGCTCTTT3′, for Ppib.
The relative expression of the Ccne1, Ccnd1, and Sall2 genes was calculated using the standard curve method, and all mRNA expressions were relative to Ppib.

To identify the presence of BaCV-Luz in bean plants and whiteflies, the total RNA was treated with TURBO DNase (Invitrogen, Carlsbad, CA, USA) to eliminate any DNA trace from the RNA preparation as described by Cao, et al. [28 (link)]. The cDNA was prepared with Anchored Oligo (dT) 20 primer (Invitrogen, Carlsbad, CA, USA) and SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA) and the PCR reactions were performed with primers specific for all BaCV genes (Table S1). The transcripts for Actin-11 (act11) [29 (link)] and the small Rubisco subunit (RbcS) [30 (link)] genes from common bean, and Ribosomal protein L9 (RpL9) [31 (link)] and Vacuolar ATPase (v-ATPase) subunit A [31 (link)] genes from whitefly, were used as internal reference controls and to identify possible transcripts ingested by the whiteflies during the feeding in the bean plants (Table S1).

For mRNA quantification, total RNA was isolated from cells 24 hours after transfection and transcribed with SuperScript II and anchored oligo-d(T)20 primer (Invitrogen). Amplification and quantification of cDNA was carried out with SYBR Green ROX Mix (Abgene, Epsome) according to the manufacturer’s protocol. qRT-PCR was carried out in 7900 HT Fast Real-Time PCR System (Applied Biosystems). For each of the selected miRNAs, real-time PCR measurements were performed to obtain a mean CT value for each sample. The CT values of the different samples were compared using the 2- ^ΔΔ CT method. The gene expression levels were normalized to β-actin levels. The sequences of primers used were shown as following: IL-6, 5′-AGCATACA GTTT GT GG ACATT-3′(forward), 5′-CAACATTCATATTGCCAGTTCT -3′(reverse); IL-1β, 5′-CAGGCAACCACTTACCTATTTA-3′(forward),5′-CCATA CACAC GGACAACAACTAGAT-3′(reverse); TNF-α, 5′-CGAGTGACAAGCCT GTAGC -3′(forward); 5′-TACTTGG GCAGAT TGACCTCA -3′(reverse); 5′-TCGTGCCTGTCTGATTCTC -3′(forward); mTOR, 5′-GATTCATGCC CTTCTCTTTGG-3′(reverse); miR144, 5′-GCGGGCGGATATCATCATAT -3′(forward); 5′-GCTACTT AGCG CGCTACTT ACTGGACA CTGG CA GTCGCGAACTGTAAG-3′(reverse);GADPH, 5′-CAT GG TCTA CATG TTCC A GT-3′(forward); 5′-GGC TAAG CAGTTGGTGGT GC -3′ (reverse).