Adenoviral vectors containing uc.372 mimic (Ad-uc.372m), USF1 (Ad-USF1), uc.372 inhibitor (Ad-uc.372i), and control vector (Ad-NC) were constructed by Genepharma (Shanghai, China). Two shRNAs (GGAGGGATGATCCAATCTAAT and GGCAGATTGTTCTAAGTGATA) against uc.372 were selected to control for off-target effects.
Ad nc
Manufactured by GenePharma
Sourced in China
Ad-NC is a laboratory equipment product designed for the packaging and storage of adenoviral vectors. It provides a controlled environment to maintain the integrity and stability of adenoviral particles.
Automatically generated - may contain errors
Lab products found in correlation
Ad usf1, by GenePharma (2 mentions)
Cli 095, by InvivoGen (1 mentions)
Z1 axio observer apotome, by Zeiss (1 mentions)
Lipofectamine 3000 transfection reagent, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Polybrene, by GenePharma (1 mentions)
Lipopolysaccharides (lps), by Merck Group (1 mentions)
10 protocols using ad nc
1
Adenoviral Vectors for miRNA Modulation
2
Intrathecal Adenovirus-Mediated Treatment for Diabetic Neuropathy
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For behavioral experiments, Ad-G6PD or Ad-NC (Shanghai Genepharma Co., Ltd) was delivered by intrathecal injection. Briefly, three days after STZ injection, Ad-G6PD or Ad-NC (5 × 109 TU/mL, 10 μL) was injected at the L5-L6 interspinous space of SD rats with microsyringe. And the adenovirus was injected again at the last day of second week. The PWT and PWL were measured at pre, one, two, three, and four weeks. CLI-095 (InvivoGen, USA) was resolved with dimethyl sulfoxide (DMSO) and administrated by intrathecal injection. The PWT and PWL were recorded before and after drug application.
3
Overexpression of uc.333 miRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Adenoviral vectors overexpressing uc.333 mimic (Ad-uc.333) and control vector (Ad-NC) were constructed by Genepharma (Shanghai, China). The adenovirus vectors were transfected into HepG2 cells at the density of 100 multiple of infection (MOI). Transfection efficiency was detected under a Zeiss Axio Observer Z1 Apotome fluorescence microscope.
4
Adenoviral-mediated ADAR1 modulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The adenoviruses constructed for overexpressing ADAR1 (Ad-O/E-ADAR1), short hairpin RNA mediating ADAR1 knockdown (Ad-shADAR1), and negative control (Ad-NC) were designed and packaged by GenePharma. RAW 264.7 cells were seeded into six-well plates. At 70-80% confluence, the cells were transiently transfected with miR-30a-5p mimic, miR-30a-5p inhibitor, or negative control (NC) siRNAs (Tsingke Biological Technology) using Lipofectamine 3000 transfection reagent (Invitrogen) according to the manufacturer's instructions. Gene silencing was observed by qRT-PCR at 48 h posttransfection.
5
Adenoviral Vectors for Arc Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The negative control adenovirus (Ad-NC), the recombinant adenovirus that expresses Arc mRNA (Ad-Arc), and the short hairpin Arc RNA (Ad-shArc) were constructed by GenePharma (Suzhou, China).
6
Overexpressed TRAF6 Transfection System
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The overexpressed transfection system of TRAF6 were constructed by using ad-TRAF6 vectors. The ad-TRAF6 vectors and the blank contrasted vectors (ad-NC) were achieved from GenePharma (Shanghai, China). The transfection process was performed relying on Lipofectamine 3000 (L3000-015, Invitrogen, Carlsbad, CA, USA).
7
Adenoviral Transduction of Linc00511 and COL1A1 in A549 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Both the empty adenoviral vector (Ad-sh-NC) and the Linc00511-specific small hairpin RNA (Ad-sh-linc00511) were provided by Hanbio Technology Ltd. (Shanghai, China) and transduced into A549 cells. COL1A1 overexpression lentiviral vectors (Ad-COL1A1) and its corresponding negative control vectors (Ad-NC) were provided by GenePharma (Shanghai, China). The adenovirus titer was approximately 1 × 1010 PFU/mL. Adenoviruses were transduced at a high multiplicity of infection (MOI; 100).
8
Adenoviral Delivery of USF1 Transcription Factor
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
9
Adenoviral Modulation of Shh Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SHH-shRNA (Ad-shSHH), SHH (Ad-SHH), and negative control (Ad-NC) adenoviruses were generated by GenePharma (Shanghai, China). The adenoviruses were delivered via intracerebroventricular injection (5 µL/rat) 4 days prior to MCAO/R, and Shh knockdown or overexpression was confirmed by assessing green fluorescent protein intensity within cerebral tissue sections as well as western blotting of homolateral ischemic tissue samples (Additional Figure 1
For adenovirus transfection, RAW264.7 cells were seeded into six-well plates, grown to 70–80% confluency, and infected with adenovirus at a multiplicity of infection of 30 in the presence of polybrene (5 µg/mL, GenePharma). After infection for 72 hours, the medium was replaced with DMEM containing 10% FBS, followed by another 48 hours incubation. Finally, fluorescence detection and western blotting were performed to assess the transfection efficiency (Additional Figure 2
For adenovirus transfection, RAW264.7 cells were seeded into six-well plates, grown to 70–80% confluency, and infected with adenovirus at a multiplicity of infection of 30 in the presence of polybrene (5 µg/mL, GenePharma). After infection for 72 hours, the medium was replaced with DMEM containing 10% FBS, followed by another 48 hours incubation. Finally, fluorescence detection and western blotting were performed to assess the transfection efficiency (
10
CTRP6 Overexpression Attenuates LPS-Induced Lung Injury
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Female C57BL/6J mice (n = 24; 8-10 weeks old), weighing 20-25 g, were acquired from Shanghai Slack Laboratory Animal Co., Ltd (Shanghai, China). Mice acquired standard chow and water in a pathogen-free room. This study was approved by the Laboratory Animals Welfare Ethics Committee of Shanxi Bethune Hospital (Shanxi Academy of Medical Sciences), and is in accordance with the National Institute of Health, Laboratory Animal Care and Use Guidelines. Mice were divided into four groups: Sham (n = 6), lipopolysaccharide (LPS; n = 6), LPS + Ad-NC (n = 6), and LPS + Ad-CTRP6 (adenovirus-mediated overexpression CTRP6; n = 6). Mice in the Sham group were intraperitoneally injected with 100 μL sterile saline, and those in the LPS group were injected with 30 mg/kg LPS (Sigma-Aldrich, St. Louis, MO, USA). Ad-NC and Ad-CTRP6 were purchased from Genepharm (Shang, China). Mice were injected with 100 μL adenovirus (10 7 particles/L) via tail vein 7 days before LPS injection. Mice in each group were anesthetized for 6 h after LPS administration. Lung tissues were collected for histologic examination, and saline was injected into tracheal cannula to collect bronchoalveolar lavage fluid for the analysis of neutrophils.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!