M mulv rt master mix

The total RNA of BMECs was extracted by TRIzol. Then, M-MuLV RT Master Mix (Sangon Biotech, China) was used to reverse transcribe cDNA on a PCR amplification instrument (C1000, Bio-Rad, USA). The cDNA synthesis system is shown in Table S4. Finally, gene-specific primers (Sangon Biotech) and 2xSG Fast RT‒PCR Master Mix (Sangon Biotech) were used for PCR amplification on a real-time quantitative PCR iCycler iQ instrument (Bio-Rad). The qPCR system is shown in Table S5, and the gene-specific primers are shown in Table S6. We calculated the fold change in RNA expression compared to that of the control using the ΔΔCt method.

We extracted RNA from BMSCs via column affinity purification (QIAGEN, Hilden, Germany) and synthesized complementary DNAs (cDNAs) using M-MuLV RT Master Mix with Oligo(dT) (Sangon Biotech, Shanghai, China). We performed real-time PCR on a StepOnePlus system (Applied Biosystems, Foster City, CA, USA) in 96-well plates with specific primers and SYBR Green Mix (Sangon Biotech). The primers (Sangon Biotech) were as follows: Lnc Tmem235-F: GGGAGAAGGT CATCTCAGGCA; Lnc Tmem235-R: GCTGTTGCTGCCTTTCTCAAGT; Lnc LOC102553514-F: CAGCGTCAGACCTCCGTCTA; Lnc LOC102553514-R: TTAA GCATTGCGGGTGCCAA; BIRC5-F: TGCCTTACGCTGAGCCTTTGC; BIRC5-R: GCCTGGAAAGCTGGGACAAGTG; miRNA-34a-3p-F: CGCGCGAATCAGCAA GTATACT; miRNA-34a-3p-R: AGTGC AGGGTCCGAGGTATT; miRNA-34a-3p-RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAGGGC; ACTB-F: CACCCGCGAGTACAACCTTC; and ACTB-R: CCCATACCCACCATCA CACC. We calculated the fold change in RNA expression compared to that of the control using the ΔΔCt method.

We extracted RNA from BMSCs via column affinity purification (QIAGEN, Hilden, Germany) and synthesized complementary DNAs (cDNAs) using M-MuLV RT Master Mix with Oligo(dT) (Sangon Biotech, Shanghai, China). We performed RT-PCR on a StepOnePlus system (Applied Biosystems, California, USA) in 96-well plates with specific primers and SYBR Green Mix (Sangon Biotech). Rabbit primers (Sangon Biotech) were as follows: Parkin-F: TGACCAGTTGCGTGTGATCTTCG; Parkin-R: GTTGTCTCCTCCAGGCGTGTTG; P53-F: ATGGAGGAG TCGCAGTCGGATC; P53-R: GGTGGTCAGCAGGTTGTTCTCAG; ACTB-F: TCCCTGGAGAAGAGCTACGA; ACTB-R: GTACAGGT CCTTGCGGATGT. We calculated the fold change value of mRNA expression over that of control using the ^ΔΔCt method.