Aqueous permanent mounting medium

PC3 and LNCaP cells were cultured on Poly L-Lysine coated coverslips in RPMI with 10% FBS, which was replaced 24 h before the experiment with RPMI containing 2% FBS. For the PI3K/FAK inhibition, cells were incubated with either Calphostin C (100 nM) or Wortmannin (10 μM) 2 h before addition of CXCL16. The cells were fixed with 4% paraformaldehyde in PBS for 10 minutes after 5 minutes CXCL16 treatment. After fixation cells were permeabilized for 5 minutes with permeabilization buffer (Cytoskeleton Inc. Denver). After washing with wash buffer (Cytoskeleton Inc. Denver), cells were incubated for 40 minutes with 100nM Rhodamine Phallodin and 20μl Alexa Fluor 488 conjugated Mouse anti-Ezrin (pY353) (BD Biosciences). After three washings the coverslip was mounted on slide in presence of aqueous permanent mounting medium (DAKO). Images were captured using Olympus microscope with 60X oil immersion objective.

The 10 μm thick sections were collected from frozen teratomas using a cryostat (Microm HM 505 N; Microm International GmbH, Dreieich, Hessen, Germany), air-dried, stained for 10 min with Harris’s hematoxylin (Sigma-Aldrich) and 40 min with Gomori trichrome (Sigma-Aldrich). Finally, sections were mounted in aqueous permanent mounting medium (Dako, Carpinteria, CA, USA). Pictures were taken using a Nikon TE200 microscope (Nikon Instruments, Tokyo, Japan) and NIS Elements software.

In-situ hybridisations were performed on frozen sections with double-DIG-labelled Hsa-miR-126-3p probe (GCATTATTACTCACGGTACGA) and scramble-miR probe (GTGTAACACGTCTATACGCCCA) (Qiagen) as the negative control. Tissue sections were hybridised at 54 °C with microRNA ISH buffer and 40 nM of the miRNA detection probe. Slides were blocked and incubated with Digoxigenin antibody [21H8] conjugated to alkaline phosphatase (AP) (Roche, Basel, Switzerland) for 1 h. NBT-BCIP substrate was applied for a minimum of an hour at 30 °C. The reaction was stopped with AP stop reaction and sections were counterstained with Nuclear Fast Red (Vector Laboratories Burlingame, CA, USA). Slides were mounted with permanent aqueous mounting medium (DAKO, Glostrup, Denmark) and analysed with an Olympus microscope equipped with an SC50, 5-megapixel colour camera.