Ge typhoon 9000

EMSA was performed to determine the binding of XRE with the dsz promoter. For this purpose, dsz promoter was Cy5 labeled by PCR amplification using Cy5 PS19 primer (5’ CAGTCATATGCGCGTATGTGTCCTCTAACCGTAAATAGCG 3’). Reaction mixture consisting of Tris binding buffer (20 mM Tris Cl, 5 mM MgCl₂, 0.1 mM EDTA, 6% sucrose, 100 mM KCl and 1 mM DTT, pH 7.5), poly d(I-C), poly L-Lysine, 12 ng of labeled promoter and increasing concentration of partially purified protein (5–20 μg) was incubated for 4 hrs at 4°C and was then run on 6% native TBE gel for 2 hrs at 100V. The gel was then scanned in a fluorimager (GE typhoon 9000) to see the shift. Two types of controls were used. First contained all the components of the reaction mixture mentioned above expect the protein and the second reaction mixture consisted of tris binding buffer, poly d(I-C), poly L-Lysine, 12 ng of Cy5 labeled dsz promoter and 20 μg of renatured washing eluate from purification (it contains other non-specific proteins present in the partially purified eluate but the protein of our interest in negligible amounts (beyond detection limit)). The reaction mixture was incubated for 4 hrs at 4°C and was then run on 6% native TBE gel for 2 hrs at 100V. The gel was then scanned in a fluorimager (GE typhoon 9000) to see the shift.