Mytaq buffer

To generate a DNA fragment for ligation, a single-stranded DNA oligonucleotide was ordered containing primer binding sites, restriction sites, and 50 random bases. There were two variants of this oligonucleotide depending on which pEVO plasmid it was intended to be used for. For the DEQSeq screen of the evolved Cas12f-ABE variants the “Cas12f UMI fragment” was used while for screen of the loxF8 recombinase variants the “loxF8 UMI fragment” was used (Additional file 3: Table S2). To make these oligonucleotides double stranded a 50 µl PCR was performed with 20 µM of the primers UMIprimer F and UMIprimer R (Additional file 3: Table S2), 10 µM of the oligonucleotide, 10 µl of 5 × MyTaq buffer and 1 µl MyTaq polymerase (Bioline). The PCR-cycler was set 94 °C for 90 s, followed by 10 cycles of 15 s at 94 °C, 15 s at 54 °C and 15 s at 72 °C. The resulting PCR product was digested with SbfI and XbaI for the Cas12f UMI fragment or BsiWI and SbfI for the loxF8 UMI fragment. The digest was then again cleaned up with the Isolate II PCR and Gel Kit (Bioline) and measured with a Qubit HS dsDNA Kit on a Qubit 2.0 (Thermo Fisher Scientific).

For insect identification, PCR was conducted using general insect DNA barcoding LepF1/LepR1 primers (LEP F1-5′ ATTCAACCAATCATAAAGATATTGG 3′; LEP R1 5′ TAAACTTCTGGATGTCCAAAAAATCA 3′) [43 (link)]. Isolated insect DNA was amplified in 30 µL PCR mix containing 17.025 µL PCR water, 6 µL My Taq Buffer (Bioline, London, UK), (5 mM dNTPs, 15 mM MgCl2, stabilizers and enhancers), 1.5 µL of each primer, 0.6 µL of 25 mM MgCl2 (Thermo Fisher Scientific, Waltham, MA, USA), 0.375 µL 1 unit My Taq DNA polymerase (Bioline, London, UK) and 15 ng/L of DNA template. The reaction was set up in a Mastercycler Nexus Gradient thermocycler (Thermo Fisher Scientific, Waltham, MA, USA) using conditions as follows: initial denaturation at 95 °C for 2 min followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 52 °C for 40 s and primer elongation at 72 °C for 1 min. The final extension step lasted for 10 min at 72 °C.

To obtain DNA for mouse-genotyping, and to screen for the presence of Pcna-mutations, Rev1-KO and Polk-KO clones, cells were lysed in lysis buffer containing ProtK overnight at 55ºC, followed by a brief inactivation of ProtK at 85ºC for 5 min. The lysate was mixed with sterile BRAUN water, of which 2 μl was used in a reaction containing MyTaq polymerase (1:100), MyTaq buffer (BioLine), and primers. DNA was amplified by PCR as indicated in Table 12.To further validate the Polk deletion, the genomic DNA of the clone was isolated using a genomic DNA isolation kit (Isolate II Genomic DNA kit, BioLine), followed by capture and exome sequencing using a HiSeq 2500 sequencing machine with 100 bp reads using paired end sequencing. The genome was aligned to the Mus musculus reference genome, and visualized using Integrated Genomics Viewer (IGV, version 2.8.6).

Cytochrome B DNA primers specific for P. auratus were designed based upon the cytochrome b sequence for voucher specimen T521, located under the GenBank accession number DQ403734 [7 ]. Primer sequences are as follows—GTF-F Forward Primer– 5`-CCCCTTACATCGGCACTGAC-3`and GTF-R Reverse Primer– 5`-CTCCAAGGATGTTTGGGGTGA-3`.Control PCR analysis in order to demonstrate that PCR quality DNA had been extracted from the environmental samples and was suitable for amplification was performed using universal 16S rDNA primers (16Sar 5’-CGC CTG TTT ATC AAA AAC AT-3’ and 16Sbr 5’-CCG GTC TGA ACT CAG ATC ACG T-3’;[12 ].
Polymerase Chain Reaction mixes were set up as master mixes to ensure consistency for all samples, with each reaction containing 1μl Bioline Taq E polymerase, 10μl 5x MyTaq buffer (Bioline), which include dNTPs, 1μl (100 pmol/μl) each of forward and reverse primers and 36μl nuclease-free H₂O. Each reaction contained 1μl of template, with DNA concentrations that ranged from 0.5–15 μg/μl depending on the sample. All PCR reactions were conducted with appropriate positive and negative controls. All samples were examined by agarose gel electrophoresis (1.5% agarose in 1 x TBE buffer) according to standard methods, staining with ethidium bromide[10 (link)].

The primers used to amplify the cytb gene are listed in Table S1. Where amplification could not be achieved with the primary PCR primers, a secondary nested PCR was performed using internal primers L14749 and H14896 as described by (Nicolas et al., 2012 (link)). PCR was performed in a 25 µL reaction volume containing 2 µL of DNA template, 0.2 µM of each primer, 0.05 U of MyTaq polymerase and 5 µL of 5X MyTaq buffer (Bioline, UK). Amplification was performed in an Eppendorf Master cycler pro 384 (Eppendorf, USA) with an initial denaturation step of 94 °C for 2 min, 30 cycles of 94 °C for 30 s, 52 °C for 30 s, and 72 °C for 1 min followed by a final extension step at 72 °C for 10 min. Amplicons were visualized on a 2% agarose gel (Thermo Fisher Scientific, CA, USA) stained with GelRed (Biotium, Australia). PCR products from positive samples were purified using AMPure XP beads (Beckman Coulter, CA, USA). The forward and reverse primers were used for cycle sequencing by the Big Dye Terminator Cycle Sequencing Kit v 3.1 (Applied Biosystems, CA, USA). Reaction products were then purified using CleanSEQ beads (Beckman Coulter, CA, USA) and sequenced on a 3130 Genetic Analyzer (Applied Biosystems CA, USA).