Lipod293

Pla2g4c promoter was amplified by PCR as previously described38 (link), and cloned into a pGL2 basic luciferase vector (Promega). Site-directed mutagenesis was performed using the QuikChange II XL Site-Directed Mutagenesis kit (Agilent Technologies) and the primers previously used38 (link).
HEK293T cells (6 × 10⁵) were transfected with pGL2-pla2g4c promoter plasmids and empty pSG5M or pSG5M-Tax (WT or mutants) plasmids using LipoD293 (SignaGen) following the manufacturer’s instructions. Luciferase activity was measured 24 h after transfection with the luciferase assay system (Promega) and chemiluminescence was detected using an EnSpire Multimode Plate Reader (PerkinElmer). The protein concentration was determined using the DC Protein Assay (Bio-Rad) to normalize for luciferase activity.

For the production of the retrovirus, Lenti-X 293T cells (catalog no. 632180, Clontech) were plated on 5- to 10-cm dishes. Encapsulation plasmids containing gag-pol and vsv-g sequences (provided by V. Borrell) were cotransfected with the plasmid of interest using LipoD293 (catalog no. SL100668, SignaGen). The medium was changed after 5 hours, and the virus was collected after 72 hours using Lenti-X concentrator (catalog no. 631231, Clontech).

Four sgRNA targeting CHMP2A were obtained from the whole-genome CRISPR library (Addgene #73179) and cloned into the sgRNA-Cas9 lentiviral vector (Addgene #52961). sgRNA#1—AGACGCCAGAGGAGCTACTG, sgRNA#2—CAAACTTGCGCACATAGCGC, sgRNA#3—TCGATGGCACAAGCCATGAA, sgRNA#4—TCTCTAGTTTCTGTCGCTCG. HEK 293FT (4 × 10⁶) were seeded the day before transfection in a 100 mm² culture dish. 24 h later cells were co-transfected with sgRNA-Cas9 lentiviral vector (5 μg) or shRNA plasmids (Sigma), pPAX (3.5 μg) (Addgene), and pMD2.G (1.5 μg) (Addgene) using LipoD293 (SignaGen Laboratories) following manufacturer’s protocol. Lentiviral supernatant was collected 48 h post transfection, filtered 0.45 μm, and concentrated using Lenti-X concentrator solution (Takara Bio). Recipient cells once reached 40–50% confluency, were infected and incubated at 37 °C ON with viral supernatant containing 10 μg/ml polybrene (EMD Millipore) and replaced 24 h later with fresh media. After 48 h, transduced cells were cultured in fresh media containing 1 μg/ml puromycin (EMD Millipore) for 2–3 days. Single clone selection was performed in Cal27 mock and KO cells seeding cells at limiting dilution after drug selection. Single clones were identified by sequencing PCR products containing amplified DNA nearby the sgRNA binding site. sgRNA#3—TCGATGGCACAAGCCATGAA has been used to generate Cal27-KO cells.

HeLa cells were seeded in a 12-well plate format at a density of 1 × 10⁵ cells per well. Twenty-four hours after seeding, cells were transfected 50 nM synthetic miRNA (miR-708 or NC miR) using INTERFERin (Polyplus) per manufacturer’s protocol. The next morning cells were transfected with the appropriate luciferase-containing plasmid using LipoD293 (Signagen, Rockville, MD, USA) per manufacter’s protocol. Six hours later media was replaced. Twenty-four hours later cells were washed with cold 1× PBS and lysed with 1× Passive Lysis Buffer (Promega, Madison, WI, USA). Luminescence was measured using the Renilla-Glo luciferase assay system (Promega) per manufacturer’s protocol using the SpectraMax M2 plate reader (Molecular Devices). Renilla luciferase activity was normalized to total protein concentration as determined by Bradford assay. Luminescence was also normalized from samples transfected with pLightSwitch_GAPDH 3′ UTR under the same miRNA condition which were also normalized to total protein concentration. All assays represent the average of ≥ 3 biological replicates.