For stable knockdown of mouse Drosha, Drosha-targeting gRNA (TACGTGGTAAGTGGTATTCT) in pCas-Guide CRISPR plasmid (Cat. No. KN304817, OriGene Technologies (Rockville, MD, USA)) was used. We used CRISPR ribonucleoprotein (RNP) system (GeneScript (Piscataway, NJ, USA)). To prepare RNA oligo, 10 μL DROSHA-targeting single guide RNA (sgRNA) Oligo (100 μM) were incubated at 95 °C for 5 min with anneal components (Nuclease-Free Water (22 μL) and Annealing Buffer (5X) (8 μL). This was put in 60 °C water and left to cool to room temperature. To prepare and transduce ribonucleoprotein (RNP) complex, WT alveolar macrophages (2 × 105 cells in 6-well cell culture plates) were seeded and transfected with RNP complex (Cas9 Nuclease (Z03386, GeneScript) 15 pmol and sgRNA oligos annealed 30 pmol) using Lipofectamine™ CRISPRMAX™ Cas9 Transfection Reagent (CMAX00003, Invitrogen) according to the manufacturer’s instructions. BMDMs were incubated for 48 h and stimulated LPS and poly(dA:dT) as described. For transient knockdown of mouse DROSHA, MISSION® esiRNA esiRNA targeting mouse Rnasen (Cat. No. EMU046711, Sigma-Aldrich) was used. WT BMDMs (2 × 105 cells in 6-well cell culture plates) were seeded and transfected with siRNA for mouse DROSHA or control siRNA for control using Lipofectamine with Plus reagent (15338-100, Invitrogen) according to the manufacturer’s instructions.
Lipofectamine crisprmax cas9 transfection reagent
Manufactured by Thermo Fisher Scientific
Sourced in United States
Lipofectamine CRISPRMAX Cas9 Transfection Reagent is a lipid-based transfection reagent designed for efficient delivery of CRISPR-Cas9 components into a variety of cell types for genome editing applications.
Automatically generated - may contain errors
Lab products found in correlation
Truecut cas9 protein v2, by Thermo Fisher Scientific (19 mentions)
Trueguide synthetic sgrna, by Thermo Fisher Scientific (5 mentions)
Geneart genomic cleavage detection kit, by Thermo Fisher Scientific (4 mentions)
Opti mem reduced serum medium, by Thermo Fisher Scientific (4 mentions)
Opti mem 1 reduced serum medium, by Thermo Fisher Scientific (4 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (3 mentions)
Kapa2g taq polymerase, by Roche (2 mentions)
Big dye protocol, by Thermo Fisher Scientific (2 mentions)
Cas9 protein, by Thermo Fisher Scientific (2 mentions)
Neon transfection system, by Thermo Fisher Scientific (2 mentions)
Alt r s p cas9 nuclease 3nls, by Integrated DNA Technologies (2 mentions)
Facsaria 2 cell sorter, by BD (2 mentions)
Precision grna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Dulbecco modified eagle medium (dmem), by American Type Culture Collection (2 mentions)
Fetal bovine serum (fbs), by American Type Culture Collection (2 mentions)
Truecut cas9 v2, by Thermo Fisher Scientific (2 mentions)
Gene knockout kit v2, by Synthego (2 mentions)
Hek293t cell, by American Type Culture Collection (2 mentions)
Plenti cmv v5 luc blast, by Addgene (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
69 protocols using lipofectamine crisprmax cas9 transfection reagent
1
Stable Knockdown of Mouse Drosha
2
CRISPR-Cas9 Knockout in RAW264.7 Macrophages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The knockout experiment was carried out in M1 macrophages from RAW264.7 cell. TrueCut™ Cas9 Protein v2 (Invitrogen™, A36498) and Lipofectamine™ CRISPRMAX™ Cas9 Transfection Reagent (Invitrogen™, CMAX00008) were utilized according to the manufacture’s guideline. The sgRNA in this experiment was purchased from Horizon (Target ID, SG-044254-01-0005; Target sequence, 5′-GGATGGGCTCTCCGTAGCGG-3′). The images were taken by Operetta High Throughput Screening (Perkin Elmer, Walthan, MA, USA), and the data were collected from Harmony 4.8 (Perkin Elmer). The fluorescent intensity was measured by the ImageJ (1.53) software, placing 10 regions of interest in randomly selected areas. The separate three experiments were proceeded with similar results. No data were excluded from the analyses.
3
CRISPR/Cas9-Mediated LRP2 Knockout in HK2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The CRISPR/cas9 gene editing technique was implemented to generate LRP2 KO HK2 cells (Fig. 1 ) employing designed sgRNA sequences (Table 1 ). HK2 cells were seeded on 24-well plate (105 cells/well). Cells were transfected by sgRNA (720 ng per reaction) and TrueCut™ Cas9 Protein v2 (3 840 ng per reaction; Invitrogen) using Lipofectamine™ CRISPRMAX™ Cas9 Transfection Reagent (Invitrogen) according to the manufacturer’s instructions 24 h after seeding. The knockout reactions were repeated twice for each sgRNA. Each transfection was performed after 48 h of recovery. The final group of cells transfected sequentially six times was designated as LRP2 KO. A group of cells transfected only once with NPMY sgRNA but twice with TMD and PPPSPS sgRNAs, was designated as partial KO (Figs. 2 A–E, 5 A and B).
4
HVEM Gene Knockout in PC3 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 50,000 PC3 cells were seeded into a 24-well plate. Twenty-four hours later, cells were incubated with sgRNA complementary to exon 3 of HVEM (GCCAUUGAGGUGGGCAAUGU + Scaffold, TrueGuide synthetic guide RNAs, Invitrogen™, ThermoFisher), Cas9 nuclease (TrueCut™ Cas9 Protein v.2, Invitrogen™, ThermoFisher), and Lipofectamine (Lipofectamine™ CRISPRMAX™ Cas9 Transfection Reagent, Invitrogen™, ThermoFisher) according to the manufacturer instructions (TrueCut Cas9 Protein v.2 (27/09/2017)). After three days, the efficiency was evaluated using the GeneArt Genomic Cleavage Detection Kit (Invitrogen™, ThermoFisher) according to the manufacturer’s instructions. For this assay, DNA was amplified using the following primers: TGCGAAGTTCCCACTCTCTG (forward) and GGATAAGGGTCAGTCGCCAA (reverse). The cells were cloned by limiting dilution in 96-well plates. Clones were screened for HVEM expression by flow cytometry using anti-HVEM (clone 94801, BD, Le Pont de Claix, France) and were considered negative if HVEM expression was undetectable for at least three subsequent measurements.
5
Generation of Ndufs3 Knockout B16-F10 Cell Line
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR/Cas9 system was used to introduce a frameshift mutation in Ndufs3 gene in B16-F10 murine melanoma cell line. In detail, Cas9 protein (Invitrogen #A36497) was transfected following manufacturer’s instructions using Lipofectamine CRISPRMAX Cas9 Transfection Reagent (Invitrogen #CMAX00015) together with synthetic RNA guides designed by Deskgen and purchased from Synthego. Exon 3 targeting guide TTGTGGGTCACATCACTCCG with PAM sequence GGG was used. Cells were split 48 hours after transfection and DNA was extracted using Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich #G1N350). Non-homologous repair efficiency was evaluated by Sanger Sequencing using KAPA2G Taq polymerase (Kapa Biosystems #KK5601) and Big Dye protocol (Life Technologies #4337451). In particular, 61°C annealing temperature was used for the PCR reaction, with primers forward CTGTAACTCCAGTCTCAGGGA and reverse CACACTGCAGGGATCACTTG. Manual clonal selection was performed in order to identify the cells with frameshift Ndufs3 mutations, leading to the generation of a pool of clones carrying the homozygous c.148A>G and c.150_151insCT mutations. DNA extraction from 96-well plates was performed using 8 μL of Lysis Solution (Sigma-Aldrich #L3289) and 80 μL of Neutralization Buffer (Sigma-Aldrich #N9784) per sample, following manufacturer’s instructions.
6
CRISPR-Mediated HDAC1/2 Knockout in THP-1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
THP-1 cells expressing Cas9 (Lai et al., 2020 (link)), generously provided by Dr. Timothy K. Lu from the Massachusetts Institute of Technology (Cambridge, MA), were plated in a 24-well plate at 5x104 cells/well in serum and antibiotic free RPMI-1640 medium with L-glutamine. For genomic editing, 7.5 pM of TrueGuide Synthetic gRNA (sgRNA) HDAC1 (CRISPR1087187_SGM), 7.5 pM of TrueGuide Synthetic gRNA (sgRNA) HDAC2 (CRISPR1097138_SGM and CRISPR1097140_SGM) or non-targeting control synthetis gRNA (csgRNA) were mixed with 1.5 μl of Lipofectamine™ CRISPRMAX™ Cas9 Transfection Reagent (all from Invitrogen) in 50 μl of Opti-MEM™ I Medium and incubated for 10 min at 37°C before adding into the cells. After overnight incubation, the cell culture medium was replaced with fresh RPMI-1640 with L-glutamine, supplemented with 10% heat-inactivated fetal bovine serum, 100 units/ml penicillin, 100 μg/ml streptomycin, 1 mM sodium pyruvate, 0.1 mM MEM nonessential amino acids (all from Invitrogen). Three weeks after transfection, the efficiency of deletion at protein levels was determined by evaluation of the protein expression in cell protein extracts by western blotting using anti-HDAC1 or HDAC2 (Cell Signaling Technology).
7
EGFP Targeting Cas9 RNP Transfection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
EGFP sgRNA targeting GFP (GAAGTTCGAGGGCGACACCC) was synthesized by Integrated DNA Technologies (IDT) Alt-R® CRISPR-Cas9 sgRNA at 10 nm scale. To generate Cas9 RNPs, Cas9 protein and EGFP sgRNA were incubated in PBS buffer for 30 min at 37°C as described previously (31 (link)). EGFP targeting Cas9 RNP transfected into the GFP stable HeLa cell line using Neon® Transfection System (Thermo Fisher Scientific) or Lipofectamine™ CRISPRMAX™ Cas9 Transfection Reagent (Invitrogen) (32 (link)). The function of Cas9 fusion protein was confirmed by In Vitro Cleavage (IVC) test, T7E1 assay, confocal microscope and western blot analysis.
8
Establishing MET Knockout Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MET knockout cells were established following a previously described method with minor modifications.29 Briefly, the Cas 9 protein (Thermo Fisher Scientific) and gRNA was transfected to CHO‐K1 cells or Flp‐In CHO cells by using Lipofectamine CRISPRMAX Cas9 Transfection Reagent (Invitrogen). The following gRNA was used: 5′‐AATGCCAGGUGACAGCACGGUGG‐3′ (Invitrogen). The knockout cells were obtained by single‐cell cloning by limiting dilution.
9
Knockout of Candidate Genes Using CRISPR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For knocking out candidate genes, several double-sgRNA vectors were constructed based on pRSG16-U6-sg-UbiC-TagRFP-2A-Puro. The primers are listed in Supplementary Table 1
To generate monoclonal knockout cell lines of TBL1XR1 in parental and olaparib-resistant 22RV1 cells (OalR), SpCas9 Nuclease (Cat. No. 1081058), tracrRNA (Cat. No. 1075927) and two crRNAs for TBL1XR1 (Supplementary Table 1
To generate monoclonal knockout cell lines of TBL1XR1 in parental and olaparib-resistant 22RV1 cells (OalR), SpCas9 Nuclease (Cat. No. 1081058), tracrRNA (Cat. No. 1075927) and two crRNAs for TBL1XR1 (
10
CRISPR-Mediated NDUFS3 Knockout
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The CRISPR/Cas9 system was used to insert a frameshift mutation in the NDUFS3 gene in SKOV3 and OVSAHO cell lines. Cas9 protein was transfected following the manufacturer’s instructions using Lipofectamine CRISPRMAX Cas9 Transfection reagent (Invitrogen #CMAX00008) together with synthetic RNA guides designed and purchased from IDT. Exon 2 targeting guide TGTCAGACCACGGAATGATG was used. Non-homologous repair efficiency was evaluated by Sanger sequencing using KAPA2G Taq Polymerase (Kapa Biosystems #KK5601) and the Big Dye protocol (Life Technologies #4337451). PCR for NDUSF3 was performed using the primers forward 5’-TCTCAAGGTGCTTCAGGGAG-3’ and reverse 5’-GAAACAAGTCTGCCCACTCC-3’. Clonal selection was carried out to select cells with frameshift NDUFS3 mutations. DNA extraction was performed following the manufacturer’s instructions using 8 µL of lysis buffer (Sigma–Aldrich #L3289) and 80 µL of neutralization buffer (Sigma Aldrich #N97784) per sample in a 96-well plate.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!