Plvx shrna1 plasmid

The colon cancer cell lines HCT116 and DLD-1 were bought from the American Type Culture Collection. DMEM supplemented with 10% fetal bovine serum (Gibco) was used to grown all cells. The FuGENE^® HD Transfection Reagent (Promega) was used for all transfections in accordance with manufacturer’s instructions. For WHSC1 knockdown, a WHSC1-specific shRNA was cloned into the pLVX-shRNA1 plasmid (Clontech). WHSC1-shRNA1: GTGCCAATAACACGTCCACT, WHSC1-shRNA2: GCCCTTCGCAGTGTTTGTCT. For a negative control, a scrambled sequence was used. Packaging was conducted with a three plasmid-system with psPAX2 and pMD2G. Lentiviral supernatant was used to infect cell lines, which were then selected for two weeks with 2 mg/mL puromycin.

Cell lines were purchased from the ATCC. We purchased RBP-Jκ, GLI, and TCF/LEF1 luciferase reporters from Shanghai Genomeditech. DMEM (containing 10% fetal bovine serum) was used to culture cells. Lipofectamine 3000 (Invitrogen) was used to transfect cell lines according to the manufacturer’s instructions. We cloned a gene-specific shRNA into the pLVX-shRNA1 plasmid (Clontech) to knockdown genes and a scrambled shRNA sequence as a control. We used the 3-plasmid system to package lentiviruses using psPAX2 and pMD2G. After transduction with the lentivirus and screening with puromycin, stable U251 and U87 cell lines were obtained. The sequences of the shRNAs are listed in Additional file 1: Table S1.

The FuGENE Transfection Reagent (Promega) was used for all transfections in accordance with manufacturer's instructions. For KDM6B knockdown, a KDM6B-specific shRNA was cloned into the pLVX-shRNA1 plasmid (Clontech). KDM6B-KD1: GTGGGAACTGAAATGGTATTT, KDM6B-KD2: GATGATCTCTATGCATCCA. For LDHA knockdown, LDHA-KD1: CAATCTGGATTCAGCCCG, LDHA-KD2: GCAAACTCCAAGCTGGTC. For a negative control, a scrambled sequence was used. Packaging was conducted with a three plasmid-system with psPAX2 and pMD2G (Clontech). The lentiviral supernatant was used to infect OS cell lines, stable cell lines were obtained after two weeks of screening with 2 μg/mL puromycin.