Pnk kinase

Two 30-mer RNA oligonucleotides (^5’GUAGUUCGCCUGUGUGAGCUGACAAACUUA^3’) harbouring a chemically modified 2’-O-methyl nucleotide at either the first or the 16^th position from the 5’ end as well as a non-modified oligonucleotide were purchased from IDT. RNAs were labelled with [³²P]pCp at their 3’ end by incubation with T4 ssRNA Ligase (NEB, #M0204S) for 1.5 hours at 37°C. RNA was precipitated with ethanol, resuspended in nanopure water and quantitated by spectrophotometry before being phosphorylated at the 5’ end by PNK kinase (NEB, #M0201S). RNA was purified by gel filtration using the Illustra Probe Quant G-50 micro columns (GE, #28-9034-08). The exoribonuclease assay was performed by incubating 2μM of recombinant DXO with 100nM of RNA in IVDA-2.1 buffer (10mM Tris-HCl pH 8.0, 5mM KOAc, 2mM MgCl₂, 0.5mM MnCl₂, 2mM DTT, 0.1mM spermidine) at 37°C for different time intervals. The reaction was stopped by the addition of EDTA to a final concentration of 100mM and reaction products were analyzed on a 20% polyacrylamide gel containing 8M urea. The radiolabeled RNA was visualized by autoradiography of the gel and was quantified with a phosphorimager (Amersham Biosciences).

Primer to generate CAV-1 targeting crRNA (AGTGTACGACGCGCACACCA)was synthesized (Integrated DNA Technologies), phosphorylated using PNK kinase (New England Biolabs) and cloned into pSpCas9(BB)-2A Puro (PX459) V2.0 (a gift from Feng Zhang, MIT, Cambridge, MA, USA; Addgene plasmid #62988) [25 (link)] to generate pTJK387. A549 cells were cultured and 105 cells are seeded into 6 well plates and transfected with pTJK387 using Lipofectamine 2000 (ThermoFisher Scientific). After 24 hours, cells were puromycin selected for 48 hours prior to being plated into 96 well plates at a concentration of 0.5 cell/ well to isolate single cell clones. Single cell clones were subsequently expanded and screened by Western Blot assay to identify Caveolin-1 knockout cell lines. The CAV-1 gene expression construct was generated by PCR amplification (CAV1α: GCTAGCCACCATGTCTGGGGGCAAATACG and GTCGACTTATATTTCTTTCTGCAAGTTGATG and cloned into GFP-marked lentivector pWCC43 [26 (link)] using Nhe1-Sal1. All constructs were validated by sequencing. These single cell clones were expanded and harvested. Protein estimation by Western Blot assay was done to confirm the outcome of genome editing (Caveolin-1 knockout) with CRISPR-Cas9 system.