Parasite growth was monitored using an Attune Nxt Flow Cytometer (Thermo Fisher Scientific, MA, USA) as previously described (Swift et al., 2020 (link); Tewari et al., 2022 (link)). For determining the growth dependence on mevalonate, cultures were seeded in the presence or absence of 50 µM mevalonate at 0.5% parasitemia and 2% hematocrit in a total volume of 250 µL, in quadruplicate for each condition. Parasite growth was monitored every 24 hr over 4 days following SYBR green I (S7563, Thermo Fisher Scientific, MA, USA) staining. For the growth curves shown in Figure 3F , the parasites were cultured in the presence of 0.5 µM aTc (control), absence of aTc (knockdown), or with 50 µM mevalonate supplementation (rescue). For growth assays presented in Figures 5E and 6E , parasites were grown in the presence of 0.5 µM aTc and absence of Shield1 (AOB1848, Aobious Inc, MA, USA) (permissive condition) or in the absence of aTc and presence of 0.5 µM Shield1 (non-permissive condition). In all the experiments presented in Figures 3F , 5E and 6E , parasite growth was monitored over 8 days. On day 4, the cultures were diluted 1:10. Data from two independent biological replicates (each in quadruplicate) of the indicated parasite lines were analyzed using a two-way ANOVA with a Sidak-Bonferroni correction in Prism V8.4 (GraphPad Software, CA, USA).
Shield1
Manufactured by Aobious
Sourced in United States
Shield1 is a lab equipment product designed to provide a safe and controlled environment for various scientific experiments and procedures. The core function of Shield1 is to create a physical barrier that isolates the work area from external factors, ensuring a consistent and controlled environment for the research or experimentation being conducted.
Automatically generated - may contain errors
Lab products found in correlation
Doxycycline, by Merck Group (3 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (3 mentions)
Dmem glutamax, by Thermo Fisher Scientific (3 mentions)
Non essential amino acids (neaa), by Thermo Fisher Scientific (3 mentions)
Thymidine, by Merck Group (3 mentions)
Dmem f12 glutamax medium, by Thermo Fisher Scientific (2 mentions)
Imr 90, by American Type Culture Collection (2 mentions)
2 deoxycytidine, by Merck Group (2 mentions)
Hct116 cell, by American Type Culture Collection (1 mentions)
Htert rpe cells, by American Type Culture Collection (1 mentions)
K562 cell, by American Type Culture Collection (1 mentions)
Iscove modified dulbecco media (imdm), by Thermo Fisher Scientific (1 mentions)
Trypsin edta, by Thermo Fisher Scientific (1 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions)
Rnaimax, by Thermo Fisher Scientific (1 mentions)
Dulbecco modified eagle medium (dmem), by Merck Group (1 mentions)
L glutamine, by Thermo Fisher Scientific (1 mentions)
Sodium pyruvate, by Thermo Fisher Scientific (1 mentions)
Phosphate buffered saline (pbs), by Merck Group (1 mentions)
Nocodazole, by Merck Group (1 mentions)
11 protocols using shield1
1
Parasite Growth Monitoring and Mevalonate Dependence
2
Culturing and Characterizing Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HAP‐1 cells (https://4dnucleome.org/cell-lines.html ) were cultured in IMDM (Gibco) supplemented with 10% fetal bovine serum (FBS) (Seradigm). K562 cells (ATCC CCL‐243), HCT116 cells (ATCC CCL‐247), and hTERT‐RPE cells (ATCC CRL‐4000) were cultured according to ATCC protocol. For HCT116, 0.05% Trypsin‐EDTA (Gibco) was used for passaging according to 4D Nucleome guidelines (https://data.4dnucleome.org/biosources/4DNSRMYUIVGD/ ). Cells were tested for mycoplasma every 2–3 months.
Cell cycle duration of hTERT‐RPE cells was estimated by passaging the cells and counting the number of seeded and harvested cells over a period of 24 and 48 h (Bio‐Rad, TC20).
HT1080 cells expressing inducible Dam‐Lamin B1 [new clone kindly provided by Kind et al (2013 )] and wild‐type HT1080 cells were cultured in DMEM supplemented with 10% FBS and 1% penicillin and streptomycin. Dam‐Lamin B1 was stabilized for 16 h with 500 nM Shield1 (Aobious #AOB1848).
Cell cycle duration of hTERT‐RPE cells was estimated by passaging the cells and counting the number of seeded and harvested cells over a period of 24 and 48 h (Bio‐Rad, TC20).
HT1080 cells expressing inducible Dam‐Lamin B1 [new clone kindly provided by Kind et al (
3
RPE Cell Culture and RNAi Experiments
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RPE cells were grown in DMEM (Sigma) supplemented with Penicillin-Streptomycin (Life Technologies), l -glutamine (ThermoFisher) and 10% fetal bovine serum (FBS) (Takarabio) at 37 °C and 5% CO2. RNAi experiments were performed using RNAiMax (Life Technologies) 2 days before treatments. The following siRNA sequences were used: siControl (5′-UGGUUUACAUGUCGACUAA-3′; Metabion), siUFD1La (5′-GUGGCCACCUACUCCAAAUUU-3′; Metabion), and siUFD1Lb (5′-CUACAAAGAACCCGAAAGAUUUU-3′; Metabion). HAI-PpoI expression was induced by adding doxycycline (1 µg/ml, Sigma) 4 h and Shield-1 (1 µM, Aobious) 1 h before fixation.
4
Synchronization and Genetic Manipulation of HeLa Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HeLa 1.2.11 cells23 (link) are from a subclone isolated from HeLa CCL-2 (ATCC), an immortal human cell line from cervical carcinoma of a 31-year-old female. Cells were grown at 37°C in Glutamax-DMEM (GIBCO) supplemented with 10% (v/v) fetal bovine serum (GIBCO), 1% (v/v) non-essential amino acids (GIBCO) and 1% (v/v) sodium pyruvate (GIBCO), at 7.5% CO2 and 5% O2. For cell synchronization, cells were treated with 2 mM thymidine (Sigma) for 16h, followed by 3x washes with pre-warmed PBS (Sigma), and released into growth medium for 8h. A second 2mM thymidine treatment was performed for 16h, followed by washes and release as above, and G1/S samples were collected 0h, G2 cells 6h and early G1 cells 8.5h after release. Expression of pRetroX-PTuner vectors carrying M.EcoGII, M-LB1 or M-TRF1 was induced by addition of 1 μM Shield-1 (Aobious) for 24 hours. Protein depletions were carried out by transfection of 5 μM short interfering RNA (siRNA) for 72h using DharmaFECT transfection reagent (Horizon). For co-depletions (3D-SIM samples), the concentrations of siRNA used were: 5 μM siCTRL (“siCTRL”), 2.5 μM siCTRL + 2.5 μM siLAP2 (“siLAP2”), 2.5 μM siCTRL + 2.5 μM siBAF (“siBAF”), 2.5 μM siBAF + 2.5 μM siLAP2 (“siBAF/siLAP2”). Samples were collected at indicated timepoints and processed further (protein extraction, RNA extraction, immunofluorescence).
5
Maintenance of RPE-1 hTERT Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Retinal pigment epithelial (RPE-1) hTERT cell lines were grown in DMEM:F12 GlutaMAX medium (Gibco) containing 1% penicillin–streptomycin and 6% FBS. Cells were cultured at 37°C in a 5% CO2 atmosphere with 21% oxygen. Chemicals used in this study: SHIELD-1 (Aobious, 1 uM) and Doxycycline (Sigma, 1 mM), Puromycin (20 ug/ml), Blasticidine (10 ug/ml). Cell lines were determined to be free from mycoplasma contamination regularly using DAPI staining.
6
Immortalization and Synchronization of Cell Lines
7
Immortalization and Synchronization of Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Early passage IMR90 (ATCC) were immortalized using retroviral infection of the catalytic subunit of human telomerase (hTERT) and grown in Glutamax-DMEM (GIBCO) supplemented with 15% (v/v) fetal bovine serum (GIBCO) and non-essential amino acids (GIBCO), at 7.5% CO2 and 5% O2. HeLa 1.2.11 and U2OS were grown in the same conditions except only 10% FBS was supplemented to the medium. Retroviruses were produced and cells were transduced as described (Crabbe et al., 2004 (link)). Induction of the pRetroX-PTuner expression vector was achieved by treating the cells with 1μM Shield1 (Aobious) for 24 hours or as indicated. For synchronization, cells were treated for 20 hours with 2mM Thymidine (Sigma), washed with PBS and released in fresh medium supplemented with 10 μmol 2-Deoxycytidine (Sigma).
8
Transient Transfection for CRISPR/Cas9 Gene Editing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For transient transfection of the sgRNAs, 1 to 6 x106 cells (lower limit for clonal experiments, higher limit for pooled experiments) were resuspended in transfection buffer (100 mM KH2PO4, 15 mM NaHCO3, 12 mM MgCl2, 8 mM ATP, 2 mM glucose (pH 7.4)) (Hendel et al., 2014 (link)). After addition of 3.0-9.0 μg plasmid, the cells were electroporated in an Amaxa 2D Nucleofector using program T-016. DD-Cas9 was induced directly for ~16 hours after transfection with a final concentration of 500 nM Shield-1 (Aobious). For uncut controls we transfected either a GFP containing plasmid or pBlue-sgRNA vector without a sgRNA sequence. To probe SSTR, 3-9 μg sgRNA was co-transfected with 1.5-4.5 μg ssODN (5′ TAGAATGCTAGCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAATTTCTACTTCATAATAAAGTGAACTCCCAGGCCATCGACAT CTCTTACCACTTCACCATCGGCAAATTTCCTACTTGGCATT 3′, Ultramer grade, IDT). The specific mutation that disrupts the PAM is underlined.
9
Generating Engineered RPE-1 Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Retinal pigment epithelial (RPE-1) hTERT cell lines (obtained from American Type Culture Collection) were maintained in DMEM/F12 GlutaMAX medium (Gibco) containing 10% Tetracycline-free Fetal Bovine Serum and 1% Penicillin-Streptomycin (10 000 U/ml). DiC-RPE-1 cells were generated by lentiviral transduction with first generation lentiviral helper plasmids of pCW-Cas9 (23 (link)). iCut-RPE-1 cells were generated by transduction of the iCut plasmid, followed by selection with Puromycin (20 μg/ml). Constitutive Cas9 expressing cells were previously described (20 (link)). Chemicals used in this study: Doxycycline (Sigma, 1 mM), SHIELD-1 (Aobious, 1 μM), Nutlin-3a (Cayman Chemical, 10 μM), Wee1 inhibitor MK-1775 (3 mM, Sigma), ATM inhibitor Ku55933 (10 μM, Merck-Millipore), ATR inhibitor VE-821 (10 μM, Selleck) and Nocodazole (250 μM, Sigma). Cells were γ-irradiated using a Gammacell Exactor (Best Theratronics) with a 137Cs source.
10
Mapping Lamin B1 Localization by Dam-ID
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HT1080 cells expressing inducible Dam‐Lamin were plated both on coverslips and in a regular culture dish and Dam‐Lamin B1 expression was activated overnight with 500 nM Shield1 (Aobious #AOB1848). Cells grown in the culture dish were trypsinized and processed with the pA‐DamID protocol, but without pA‐Dam or Dam added. The cells were then fixed on poly‐L‐lysine‐coated coverslips as described above. As soon as the culture dish cells were permeabilized, the cells on coverslips were fixed with 2% formaldehyde/PBS for 10 min, permeabilized for 20 min with 0.5% NP‐40/PBS and blocked with 1% BSA/PBS for 1 h. Next, coverslips were incubated for 1 h at room temperature with 1:500 Lamin B1 antibody (Abcam ab16048, rabbit) and washed 3× with PBS. PBS with 1:500 m6A‐Tracer protein (1.15 mg/ml) and 1:500 secondary anti‐rabbit antibody (Jackson 711‐585‐152, donkey, Alexa 594) was added and incubated for 1 h, followed by washing with PBS (3×) and H2O (1×), and mounted with Vectashield + DAPI. For comparison, wild‐type HT1080 cells (not expressing Dam‐Lamin B1) were subjected to pA‐DamID using Lamin B2 antibody and processed as the HT1080 Dam‐Lamin B1 HTC75 cells.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!