K562 cells were transfected with plasmid RC2016029 containing the MPO coding sequence with a C-terminal MYC-DDK tag in the vector pCMV 6-Entry (Origene, Rockville, MD). Transfection was performed using Dharmafect Duo (Dharmacon, Amersham, UK) transfection reagent. Transfection mixtures contained 1 µg/ml of MPO plasmid (Origene) or G418 control plasmid with 20 µg/ml of Dharmafect Duo (Dharmacon) and 80% v/v serum-free RPMI 1640 medium. After selection with G418 (750 μg/ml), clonal lines were isolated by limited dilution. MPO-expressing lines were continuously grown in 500 µg/ml G418, the selection antibiotic. MPO expression was assessed using immunofluorescence and MPO activity assays.
Dharmafect duo
Manufactured by Horizon Discovery
Sourced in United States, United Kingdom
The DharmaFECT Duo is a transfection reagent used for the delivery of small interfering RNA (siRNA) and plasmid DNA into mammalian cells. It facilitates the uptake of nucleic acids, enabling gene knockdown and gene expression studies.
Automatically generated - may contain errors
Lab products found in correlation
Dual luciferase reporter assay system, by Promega (6 mentions)
Prl sv40, by Promega (4 mentions)
Pmir report plasmid, by Thermo Fisher Scientific (4 mentions)
Dharmafect 1, by Horizon Discovery (4 mentions)
Dual glo luciferase assay system, by Promega (3 mentions)
Lipofectamine rnaimax, by Thermo Fisher Scientific (3 mentions)
Pmir report vector, by Thermo Fisher Scientific (2 mentions)
Turbofect, by Thermo Fisher Scientific (2 mentions)
Oligofectamine, by Thermo Fisher Scientific (2 mentions)
Prl cmv, by Promega (2 mentions)
Opti mem, by Thermo Fisher Scientific (2 mentions)
Pmir report, by Promega (2 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (2 mentions)
Psicheck 2 vector, by Promega (2 mentions)
Dharmafect 2, by Horizon Discovery (2 mentions)
Pcmv6 entry, by OriGene (1 mentions)
Pyruvate, by Thermo Fisher Scientific (1 mentions)
Blasticidin s hcl, by Thermo Fisher Scientific (1 mentions)
Attune nxt flow cytometer, by Thermo Fisher Scientific (1 mentions)
58 protocols using dharmafect duo
1
Overexpression of MPO in K562 Cells
2
MiR-215 Regulation of MSH6 and H3F3B
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A 618 nucleotide portion of the MSH6 mRNA coding region was determined to contain a sequence complementary to the seed sequence of miR-215 and was cloned into pMIR-Report Vector (Life Technologies) using forward primer: CGAGCTCGCACGAGTGGAACAG and reverse primer: CGACGCGTACCACCTAGAGCAGA. A 1425 nucleotide portion of the H3F3B 3′-UTR which was predicted to be targeted by miR-215 was also cloned into pMIR-Report Vector using forward primer: CGACGCGTGTGAAGGCAGTTTTT, and reverse primer: CGCGCCGTTTAAACCTGAGTTCTACACCT. Twenty-four hours before transfection, 1.5 × 104 cells were plated in a 96-well plate. 10 nM of miR-215 or control miRNA was transfected into these cells together with 100 ng of pMIR-Report-MSH6 or pMIR-Report-H3F3B and 1 ng of Renilla luciferase plasmid pRL-SV40 (Promega) with DharmaFect Duo (Dharmacon) following the manufacturer's protocol. The luciferase assay was performed 24 h after transfection with the dual-luciferase reporter assay system (Promega). For each sample, firefly luciferase activity was normalized to Renilla luciferase activity and the inhibition by miR-215 was normalized to the control miRNA and repeated 3 times.
3
CRISPR-based reporter assay for target cleavage
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Target sites were cloned into a pRGS backbone (PNA Bio Inc.) containing an RFP reporter and two out-of-frame GFP reporters, as previously described63 (link). gRNA was annealed as described above. HeLa-Cas9 cells (previously authenticated and shown to be free of mycoplasma)11 (link) were cultured in high-glucose DMEM media with pyruvate (Gibco) supplemented with 10% FBS/1× pen-strep/1× glutamine (Gibco) and 5 µg mL−1 Blasticidin S HCl (Gibco) at 37 °C in 5% CO2. Transfection of the HeLa-Cas9 cells was performed using DharmaFECT Duo (Dharmacon), according to manufacturer instructions for the CRISPR system. The degree of target sequence cleavage was calculated based on the %GFP + /%RFP + cells using an Attune NxT Flow Cytometer (Invitrogen).
4
Knockdown of RhoGAP and IQGAP1 in HEK293 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293 cells were transfected with p122RhoGAP/DLC‐1 siRNA (sense, 5′‐GAAACGCCUUAAGACACUATT‐3′; antisense, 5′‐UAGUGUCUUAAGGC GUUUCTT‐3′; TaKaRa Biotechnology Co., Ltd., Kyoto, Japan), IQGAP1 siRNA (s16837; Applied Biosystems, CA, USA), or negative control. The cells were transfected by siRNA (final concentration: 100 nmol/L) at 70%‐80% confluency using a transfection reagent, DharmaFECT Duo (T‐2010‐03; Dharmacon, CO), in the complete medium, as per the manufacturer's instructions.
5
CRISPR/Cas9 Knockout of Flotillin-1 in MDA-MB-231 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR/Cas9 genome editing to generate MDA-MB-231 lacking functional flotillin-1 was performed using the Edit-R CRISPR/Cas9 system from Dharmacon (Lafayette, CO), as per manufacturer instructions. Briefly, cells were incubated with a mixture of 0.75 pmoles of Edit-R crRNA targeting flotillin-1 (catalog CM-010636-04-0002), 0.75 pmoles of Edit-R tracrRNA (catalog no U-002005-20), 200 ng of Edit-R hCMV-mKate2-Cas9 DNA plasmid and 15 μL of Dharmafect Duo (Dharmacon) transfection reagent in 300 μL of Opti-MEM media (Thermo Fisher Scientific). Single MDA-MB-231 cells expressing mKate2 were isolated using fluorescence-activated cell sorting; each single cell was grown into separate clonal populations, which were then screened for successful knockout of flotillin-1 by immunoblotting and immunofluorescence microscopy.
6
Astrin Protein Transfection and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
siRNA transfection was performed using Oligofectamine (Fisher; 12252011) according to the manufacturer’s instructions. Astrin siRNA oligo (UCCCGACAACUCACAGAGAAAUU) and Negative control siRNA (12,935–300) were from Invitrogen. Plasmid transfection was performed using TurboFect (Fisher; R0531) or DharmaFECT duo (Dharmacon; T-2010) according to manufacturer’s instructions. In addition to the standard protocol, after 4 h of incubation, the transfection medium was removed and a fresh selected pre-warmed medium was added to each well. In co-transfection studies, eukaryotic expression vectors encoding Astrin-GFP and mCherry-GBP were used in a 3:1 ratio. mCherry-GBP-PP1γ expression plasmid was generated by subcloning 7–300 of PP1γ into an mCherry-GBP expression plasmid. Astrin mutants are described in35 . Astrin fragments (694–1193 a.a and 851–1193 a.a) encoding vectors were constructed through Gibson assembly using Astrin full-length cDNA (Q96Q06). Plasmid vector sequences were confirmed by DNA sequencing. Both plasmid DNA and plasmid maps are deposited in Ximbio.com.
7
Transient Transfection Luciferase Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All transient transfections were conducted by using Dharmafect Duo (Dharmacon, Thermo Scientific). The pMIR-CDK6 and pMIR-β-gal plasmids were used as reporter constructs. The cells were harvested 72 h after transfection, lysed in reporter lysis buffer, and subsequently assayed for their luciferase activity (Luciferase Assay System, Promega). The transfections were performed in duplicate per each experiment. The luciferase assays were normalized according to their β-galactosidase activity.
8
MicroRNA Mimic Library Screening
9
Transient Transfection and RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Prior to transfection, cells were seeded into 6-well plates (Corning) at 2.5 × 106 cells and 2 ml media per well. After 24 h, each well was co-transfected with 2.5 μg plasmid (25% p2032-GFP, 75% pUC19) plus 25 nM miRNA duplex (or for mock transfections, with plasmid only) using 5 μl DharmaFECT Duo (Dharmacon, Lafayette, CO, USA). Equal volumes of nucleic acid and DharmaFECT Duo diluted in 1× phosphate-buffered saline (PBS) were combined and incubated at room temperature for 20 min to form transfection complexes that were then added dropwise to the cells (500 μl/well). Twenty-four hours after transfection, cells were harvested, resuspended in 1× PBS, passed through a 70-μm filter, and stained with 5 μg/ml propidium iodide (PI). For each transfection, 3–5 × 106 GFP-positive and PI-negative cells were isolated by FACS and lysed in 1 ml TRI Reagent (Ambion). Following extraction from the lysate, total RNA was cleaned up using the RNeasy Mini Kit (Qiagen, Hilden, Germany) and subjected to poly(A) selection using oligo(dT) Dynabeads (Invitrogen) to isolate mRNA.
10
Screening microRNA Regulators of CXCL8
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A human mimic microRNA library consisting of 2080 unique siRNA corresponding to known human microRNAs (MiRIDIAN, ThermoFisher) was used for screening microRNA that interact with the 3′-UTR of human CXCL8 mRNA. Immortalized colon fibroblasts (CT5 SV40) were seeded at 8000 cells per well in 96-well plates the day before transfection. These cells were immortalized via lentiviral transduction of hTERT SV40 (kind gift from Rosa Hwang, MD, MD Anderson). The next day each well of cells was co-transfected with unique library microRNA mimics (50 nM/well) and pMIRGLO-CXCL8-3′UTR plasmid using Dharmafect Duo (GE Dharmacon) according to the manufacturer protocol. After 48 hours luminescence was measured using DualGlo Luciferase Assay System (Promega) with a Spectra II plate reader (Molecular Devices). A non-targeting negative control and a positive control in form of a siRNA targeting the 3′UTR of human CXCL8 mRNA (5’-AUU CUA GCA AAC CCA UUC AUU-3′, Dharmacon) were included for each individual mimic 96-well plate screen.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!