Morpholino antisense oligos mo

Morpholino antisense oligos (MO) were purchased from Gene Tools (Philomath, OR, United States) (Fujii et al., 2020 (link)). Zebrafish 1-cell embryos were injected with approximately 5 nL of MO solution at a concentration of 200 μM (approximately 10 ng/embryo).
The MO sequences used are listed below.
Negative Control (5′-CCT​CTT​ACC​TCA​GTT​ACA​ATT​TAT​A -3′).
DrHCN4 (5′-GTA​ATT​ACT​GCC​ACC​GTG​CAC​CAC​A-3′).
DrHCN4L (5′-GGC​GAC​GCT​GGC​TGA​AAA​ATA​GGT​C -3′).

Morpholino antisense oligos (MO; Genetools) designed to recognize the 5′UTR of cyclin B1, Cdc20 and APC3 were microinjected at a micropipette concentration of 1 mM. Cyclin B1 MO and cyclin B1 5 base pair mismatch (5bpmm) MO oocytes were released from arrest within 30 minutes of injection since we did not want to perturb prophase levels of cyclin B1, but only to prevent such excessive accumulation in prometaphase. APC3 MO and APC3 5bpmm MO injected oocytes were arrested in prophase with IBMX for 6 hours prior to release. A short Cdc20 MO incubation period (1.5-2 hours) was carried out as previously described (Reis et al., 2007 (link)). A longer Cdc20 MO incubation period required the use of cycloheximide since oocytes began to escape IBMX induced prophase arrest approximately 3 hours after injection of the Cdc20 MO. We reasoned that, without sufficient Cdc20 available to suppress prometaphase cyclin B1 levels, a premature increase in cyclin B1 drove oocytes out of prophase. Therefore, a longer Cdc20 MO incubation period included cycloheximide to prevent this. To release prophase arrest, both IBMX and cycloheximide were washed out from oocyte containing media; the use of cycloheximide in prophase arrest did not perturb subsequent MI maturation or cyclin B1 destruction profiles in control oocytes.

Morpholino antisense oligos (MO) were designed to block translation or splicing (Gene Tools, Inc.) including: fat3-MO1, 5′-CCTTCACCTGTGCAAACAGAGAACA-3′; fat3-MO2, 5′-TGCCCTCTTGCTCAGTTCGGCTCAT-3′; dchs2-MO1, 5′-CATGTTCATGC-GAAAACATTAGCAG; dchs2-MO2, 5′-AGAAAGTCCGTGTGTAAAACTCCAT-3′; Sox9a i1d, 5′-AATGAATTACTCACCTCCAAAGTTT-3′[62] (link); Sox9a i2d, 5′-CGAGTCAAGTTT-AGTGTCCCACCTG-3′ [62] (link). MOs were prepared at 1 mM in dH2O and stored at room temperature. To construct fat3-5′UTR-eGFP and dchs2-5′-UTR-eGFP reporter genes, cDNA amplicons containing target sites of MOs were subcloned in frame into the pCS2-eGFP vector. MO- and mRNA injection volumes were approximately 500 pL. A 4 hr developmental delay was usually observed with MO-injected- and rerea^−/− embryos, which was corrected for throughout the study.

Zebrafish embryos were microinjected at 1 cell stage with an Olympus SZX9 and a Picospritzer III microinjector (Parker Instrumentation). Injection mixes were composed of Danieau solution 1×(NaCl 58 mM, KCl 0.7 mM, MgSO₄ 0.4 mM, Ca(NO₃)₂ 0.6 mM, HEPES 5.0 mM, pH 7.6), Phenol red 0.1% and Morpholino (MO) antisense oligos (Gene Tools). Each embryo was injected, respectively, with 1.7 ng of splice-blocking baiap2b MO, 5′-TTCGGGCACTACATGAGTGACCTT-3′, and 1.7 ng of 5′-UTR baiap2b MO, 5′-AAAGGTCACTCATGTAGTCGCCGAA-3′, together.

Zebrafish embryos were microinjected with an Olympus SZX9 and a Picospritzer III microinjector (Parker Instrumentation). Injection mixes were composed of Danieau solution 1X (NaCl 58 mM, KCl 0.7 mM, MgSO₄ 0.4 mM, Ca(NO₃)₂ 0.6 mM, HEPES 5.0 mM, pH 7.6), Phenol red 0.1% and Morpholino (MO) antisense oligos (Gene Tools). Each embryo was injected respectively with 1.7 ng of splice blocking snap29 MO^{14 (link)}, 1.7 ng of splice-blocking snap29 together with 200 pg GFP-snap29 mRNA for the rescue, 3 ng of 5′-UTR snap25 a,b MO, or 3 ng of ATG bdnf MO^{51 (link)}.

Xenopus laevis and Xenopus tropicalis were purchased from Nasco or the National Xenopus Resource (RRID:SCR_013731) and experiments were performed according to CCHMC IACUC approved protocols. Embryos were staged according to Nieuwkoop and Faber, 1967 . Microinjection and embryo culture were performed as previously described (Stevens et al., 2017 (link)). Antisense morpholino oligos (MO; GeneTools, LLC) were as follows:
Total amounts of MO injected into X. tropicalis embryos were as follows: 2 ng Bcat MO, 8 ng sox17 MO (4 ng each a+b1/2 MO), 8 ng standard control MO.
Synthetic mRNA for injections was generated using the Message Machine SP6 transcription kit (Thermo Fisher AM1340) using the following plasmids: pCS2+ human B-catenin S37A caBCAT (Zorn et al., 1999 (link)); pcDNA6-V5-mouse Sox17 (mSox17) and pcDNA6-V5-Sox17 M76A (Sinner et al., 2007 (link)); pCS2+ Tcf7l1:VP16 (formerly XTcf3:VP16) (Darken and Wilson, 2001 (link)).

Capped synthetic mRNAs were generated by in vitro transcription with SP6 polymerase, using the mMessage mMachine kit (Ambion/Life Technologies). For microinjections, embryos were injected with 5–10 nl of the specified amount of mRNA in 3% Ficoll in 0.1 × MMR and cultured in 0.1 × MMR until the desired stage. The site of injection was determined based on the cell fate map of Xenopus embryos [23 (link)]. nucß-gal mRNA for WISH and membrane RFP (memRFP) mRNA as well as membrane GFP (memGFP) mRNA for immunohistochemistry were injected as a lineage tracer. Antisense Morpholino Oligos (MO) and standard control MO were purchased from Gene Tools. Sequences of MO used in this work are followed. Control MO (conMO): CCTCTTACCTCAGTTACAATTTATA, LARP6 MO (L6MO): TCTCCTCGGGCTCCTCCATGTCACT. Mismatches between LARP6 S, whose sequence was used in this study, and LARP6 L (accession number BJ030119) are four nucleotides including missing three nucleotides in the middle of MO.