Pegfp n1 plasmid vector

The HEK293 eukaryotic cell line was cultured in a DMEM culture medium (PanEco, Moscow, Russia) supplemented with 10% fetal bovine serum (Dia-M, Moscow, Russia) and maintained in 5% CO₂ and a 98% humidity atmosphere. The transfection of the HEK293 cells with plasmid and RNP was performed using Lipofectamine™ 3000 Transfection Reagent (Invitrogen, USA), Lipofectamine™ CRISPRMAX (Invitrogen, Waltham, MA, USA) and TurboFect (ThermoFisher, Waltham, MA, USA) in accordance with the manufacturer’s instructions. For plasmid transfection, 300 ng of Cas9 coding vector and 200 ng of ssODN (see Table S1) were used. For the RNP transfection, 20 pmol (3300 ng) of the complex was used; 200 ng of ssODN oligonucleotide was used for cotransfection to achieve HDR.
The HEK293T stable GFP transfected cell line was obtained using transfection with pEGFP-N1 plasmid vector (#V012021 Clontech, Changhai, China) and subsequently subcloned. The level of GFP expression was visually examined until a stably transfected cell line was obtained.

For subcellular localization study of BmKRP, the ORF DNA fragment of BmKRP was PCR amplified with a FLAG tag and a His-tag between Kpn I and BamH I with forward primer: 5′- GGTACCGATGGATTACAAGGATGACGACGATAAGGGTTCAAAGATACCAG-3′ and reverse primer: 5′- GGATCCCGGTGATGATGATGATGATGAATTTTTATAACCATA-3′ and cloned into pEGFP-N1 plasmid vector (Clontech Laboratories Inc., Mountain View, CA, USA), generating a recombinant plasmid vector, BmKRP-EGFP. BmKRP-EGFP was transfected into BmN cells. BmKRP-EGFP protein was localized by observing the green fluorescence signal under a laser confocal microscope (Carl Zeiss AG, Oberkochen, Germany) at 24 h after transfection. The vector expressing EGFP alone was used as control. The nuclei were counterstained by DAPI.