The natural killer cell lymphoblastic leukemia (YTS) cell line expressing CD56,57 (link) was cultured at 37°C in RPMI 1640 (Gibco Life Technologies) supplemented with Penicillin/Streptomycin (Gibco Life Technologies), non-essential amino acids (Gibco Life Technologies), 1mM Sodium Pyruvate (Corning Cellgro), 1M HEPES solution (Gibco Life Technologies), and L-Glutamine (Gibco Life Technologies). STAT1 mutant NK cell lines were generated by CRISPR-Cas9 gene editing and performed by nucleofection of 5 ug of GeneArt CRISPR Nuclease Vector plasmid containing the guide sequences ATCACTCTTTGCCACACCATGTTT, ACTGTTGGTGAAATTGCAAGTTTT, and TTCAGCCGCCAGACTGCCATGTTTT (Life Technologies) using the Amaxa nucleofector and Lonza-Kit R. 24 hours post-nucleofection GFP positive cells were sorted. Single clones were expanded and STAT1GOF positive cells were confirmed by flow cytometry.
Myelocult h5100 medium
MyeloCult H5100 is a serum-free, xeno-free medium designed for the expansion and maintenance of human hematopoietic stem and progenitor cells in culture. It contains essential nutrients, growth factors, and cytokines required for cell growth and differentiation.
Lab products found in correlation
15 protocols using myelocult h5100 medium
Characterization of NK Cell Lines
Culturing Breast Cancer and NK Cell Lines
In vitro Hematopoietic Differentiation
Evaluating Long-Term Hematopoietic Niche Reconstitution
The frequency of LTC‐IC in the starting cell population and the average number of CFU derived from each LTC‐IC were calculated as previously reported.
Hematopoietic Support Ability of BMSCs
Assessing Cell Cycle Progression of Human Hematopoietic Stem Cells
Single Human HSC Maintenance and Expansion
Modeling AML-ME Leukemic Cell Niche
AML- or HD-induced adipocytes/osteocytes were then cultured in the MEM-α. CD34 + cells derived from either leukemic or CB cells were co-cultured (for 10 days) with the above MSC feeder layer at a density of 2 × 104 cells/cm2 in the MyeloCult™ H5100 medium (STEMCELL Technologies Inc, cat. #H5100) with the addition of 1% penicillin–streptomycin solution. Cells were trypsinized, harvested and sorted for CD45 + cells, using CD45 Microbeads (human; Miltenyi Biotec, cat. #130–045-801) for simultaneous conduction of the colony forming unit (CFU) assay. The cell viability was assessed using the flow cytometry analysis.
Pesticide-Exposed BM-MSCs and CD34+ Hematopoietic Progenitor Assay
Multifaceted Analysis of Hematopoietic Progenitor Cells
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!