Qscript xlt one step rt qpcr toughmix

RNA was extracted from 50 µl of filtered house fly homogenate, 140 µl of filtered swab medium and 140 µl of the respective feeding substrate solution using the QIAamp Viral RNA Mini Kit (Qiagen) according to the manufacturer’s instructions. The quantitative reverse transcription-PCR (RT-qPCR) assay was performed according to the RT-qPCR protocol established by the US Centers for Disease Control and Prevention (CDC) for the detection of the SARS-CoV-2 nucleocapsid (N)-specific RNA (https://www.fda.gov/media/134922/download) using the N2 primer and probe set and the qScript XLT One-Step RT-qPCR Tough Mix (Quanta Biosciences, Beverly, MA, USA) on a CFX96 real-time thermocycler (Bio-Rad, Hercules, CA, USA). The PCR plate controls included a quantitated SARS-CoV-2 N-specific qPCR positive control, diluted 1:10 (Integrated DNA Technologies, Coralville, IA, USA), and a non-template control (NTC). The results were analyzed using Bio-Rad CFX Manager 3.1 software. Samples with Cq values of < 38 were considered positive for SARS-CoV-2 RNA. A reference standard curve method using  SARS-CoV-2-specific RNA as a standard was used for calculating the SARS-CoV-2 copy number of each sample, as previously described [3 (link), 19 (link)].

To study BMV RNA2 translation in the absence and presence of hTRPV4, WT (Saccharomyces cerevisiae Meyen ex E.C. Hansen (ATCC^® 201388^™) and ΔYvc1 (YSC1053 (ThermoFisherScientific) yeast strains were transformed with pB2NR3. The ΔYvc1 strain was additionally transformed with pBT3-STE-TRPV4 or an empty plasmid. Cells were grown in 2% galactose and harvested in mid-log phase. Total protein was extracted and analyzed by western blot as previously described^{66 (link)}. Total RNA was extracted and RNA2 and Act1 were analyzed by quantitative PCR (qPCR) using qScript XLT One-Step RT-qPCR ToughMix from Quanta Biosciences.

HCV genomic RNA extracted from the fractions was analyzed by one-step qRT-PCR using qScript XLT one-step RT-qPCR ToughMix (Quanta Bio-sciences) according to the manufacturer’s instructions. Briefly, 15 µl of reaction mixture contained 7.5 µl of 2× RT mix, 1 µM of JFH1-specific and Renilla-specific primers (JFH1 S146 forward qPCR primer: TCTGCGGAACCGGTGAGTA, JFH1 A219 reverse qPCR primer: GGGCATAGAGTGGGTTTATCCA, Renilla S767 forward qPCR primer: AATCGGACCCAGGATTCT, Renilla A917 reverse qPCR primer: ACTCGCTCAACAACGATTT), 0.27 µM of the corresponding probes (JFH1 TaqMan probe: [FAM]AAAGGACCCAGTCTTCCCGGCAATT[TAMRA], Renilla S859 TaqMan probe: [HEX]TCGCAAGAAGATGCACCTGATGA[TAMRA]), 3 µl of template RNA, and RNase-free water. To generate a standard curve, serial dilutions of an RNA standard (10⁷–10⁹ copies of HCV RNA and Renilla in vitro transcript) was prepared for each plate. Reactions were performed using the following program: 50 °C for 10 min, 95 °C for 1 min, and 40 cycles of amplification: 95 °C for 10 s and 60 °C for 1 min. The amount of HCV RNA was normalized to the Renilla control and the input sample.

RNA was extracted from 1×10⁶ splenocytes and xenografts using the PureLink^® RNA Mini Kit (Invitrogen, Life Technologies) according to the manufacturer’s protocol and aliquoted at -80°C. RT-qPCR was performed with qScript™ XLT One-Step RT-qPCR ToughMix^® (Quanta Biosciences, Gaithersburg, US) and the TaqMan primer/probe sets from Applied Biosystems, Life Technologies, for Perforin 1 (Mm00812512), granzyme A (Mm00439191), granzyme B (Mm00442834) and granzyme K (Mm00492530) using the 7500 Fast Real-Time PCR System (Life Technologies). GAPDH (TaqMan Rodent GAPDH control reagents, Applied Biosystems) was used as housekeeping gene and all analyses were performed using GAPDH normalization. Relative gene expression was calculated using the 2^-ΔΔCt method.

Real time PCR was conducted essentially as previously described [6 (link)]. Total RNAs were extracted (Trizol, Invitrogen) 6 hours post-addition of TGFβ1 and the concentration and integrity of the extracted RNA sample was measured using a Nanodrop 2000 (Thermo) and Agilent 2100 Bioanalyzer (Agilent Technologies Inc., Palo Alto, CA) using the RNA 6000 Nano kit (Caliper Life Sciences, Mountain View, CA). The extracted RNA samples (50 ng) were reversed transcribed and amplified using TaqMan Human gene Expression assays (Applied Biosystems) in a 15-μL reaction containing qScript™ XLT One-Step RT-qPCR ToughMix (Quanta Biosciences) TaqMan Assays-on-demand Human gene specific primers (Applied Biosystems), 6-carboxyflurosceinlabeled gene specific TaqMan MGB probe (Applied Biosystems). The ViiA™ 7 Real-Time PCR System and ViiA™ 7 Software were used for the detection and analysis of the amplified signal according to manufacturer’s instructions (Applied Biosystems). Triplicate samples were run, and experiments were repeated on three independent occasions, and averages +/- SEM (N = 3) calculated. Single factor ANOVA and Tukey's Post Hoc analysis were used for statistical analysis (GraphPad Prism software).

A yeast strain with an integrated TIR1 was used for the generation of a genomic fusion of Xrn1 to an auxin-induced degron (AID). Together with TIR1, this fusion enabled the quick degradation of Xrn1 protein upon addition of auxin, taking advantage of a protein degradation pathway in plants^{18 (link)}.
Yeast cells transformed with BMV RNA2-Rluc plasmid were grown in SC media with 2% raffinose until they reached exponential phase and an OD₆₀₀~0.5 in 50 ml cultures. Galactose (2%) and auxin (500 µM) were added to induce BMV RNA2-Rluc expression and deplete Xrn1, respectively. Samples were taken at different time-points for OD measurement, Luciferase activity assay and total RNA extraction. BMV RNA2-Rluc was quantified by reverse transcription quantitative PCR using TaqMan probes and the qScript XLT One-Step RT-qPCR ToughMix (Quanta Biosciences).