Anti ash2

Chromatin Immunoprecipitation (ChIP) assays were performed essentially as described before (Li et al., 2018d (link); Li Z. et al., 2019 (link); Shao et al., 2019 (link); Weng et al., 2019 (link); Yang et al., 2019 (link)). In brief, chromatin in control and treated cells were cross-linked with 1% formaldehyde. Cells were incubated in lysis buffer (150 mM NaCl, 25 mM Tris pH 7.5, 1% Triton X-100, 0.1% SDS, 0.5% deoxycholate) supplemented with protease inhibitor tablet and PMSF. DNA was fragmented into ∼200 bp pieces using a Branson 250 sonicator. Aliquots of lysates containing 200 μg of protein were used for each immunoprecipitation reaction with anti-BRG1 (Santa Cruz, sc-10768), anti-p300 (Santa Cruz, sc-585), anti-c-Jun (Santa Cruz, sc-1694), anti-Fos (Santa Cruz, sc-166940), anti-SMAD3 (Abcam, ab28379), anti-ASH2 (Bethyl Laboratories, A300-489A), anti-JMJD2B (Bethyl Laboratories, A301-478), anti-anti-acetyl H3 (Millipore, 06-599), anti-trimethyl H3K4 (Millipore, 07-449), anti-trimethyl H3K9 (Millipore, 07-441), or pre-immune IgG. For re-ChIP, immune complexes were eluted with the elution buffer (1% SDS, 100 mM NaCO3), diluted with the re-ChIP buffer (1% Triton X-100, 2 mM EDTA, 150 mM NaCl, 20 mM Tris pH 8.1), and subject to immunoprecipitation with a second antibody of interest.

Chromatin immunoprecipitation assays were performed essentially as described before (Liu et al., 2018 (link), 2019a (link),b (link); Zeng et al., 2018 (link); Zhang et al., 2018 (link); Li et al., 2018a (link)–e (link), 2019b –f ; Yang Y. et al., 2018 (link); Yang et al., 2019a (link),b (link); Fan et al., 2019 (link); Lu et al., 2019 (link); Shao et al., 2019 (link); Weng et al., 2019 (link); Zhao et al., 2019 (link); Kong et al., 2019a (link),b (link)). Briefly, chromatin was cross-linked with 1% formaldehyde. DNA was fragmented into 500 bp pieces using a Branson 250 sonicator (30% output power; 6 cycles of 10s sonication + 10s intermission). Aliquots of lysates containing 200 μg of protein were used for each immunoprecipitation reaction with anti-MRTF-A (Santa Cruz, sc-32909), anti-Tip60 (Santa Cruz, sc-166323), anti-trimethyl H3K4 (Millipore, 07–473), anti-acetyl H3K9 (Millipore, 07–352), anti-acetyl H3K27 (Millipore, 07–360), anti-acetyl H4K16 (Millipore, 07–328), anti-ASH2 (Bethyl Laboratories, A300–489A), or pre-immune IgG. Precipitated DNAs were amplified with the following primers: Nos2 promoter, 5′-AGAGTGATGTAATCAAGCAC-3′ and 5′-AAAGTTGTGACCCTGGCAG-3′; Gapdh promoter, 5′-ATCACTGCCACCCAGAAGACTGTGGA-3′ and 5′- CTCATACCAGGAAATGAGCTTGACAAA -3′.