The largest database of trusted experimental protocols

Geneart mutagenesis kit

Manufactured by Thermo Fisher Scientific

The GeneArt mutagenesis kit is a laboratory tool designed for introducing site-specific mutations into DNA sequences. The kit provides a streamlined workflow and reagents to facilitate the mutagenesis process.

Automatically generated - may contain errors

3 protocols using geneart mutagenesis kit

1

Recombinant RaaS Protein Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols
The M. tuberculosis raaS gene was cloned into the NdeI and NheI sites of the pET15-Tev plasmid to generate a hexahistidine-tagged recombinant protein (4 (link)). Protein expression in Escherichia coli BL21(DE3) was induced by isopropyl β-d-thiogalactopyranoside at a final concentration of 0.2 mm. Recombinant RaaS was purified using a HiTrap 1-ml IMAC HP column (Amersham Biosciences). Site-directed mutants of RaaS were generated using a GeneArt mutagenesis kit (Invitrogen) according to the manufacturer's instructions.
+ Open protocol
+ Expand
2

Generation and Modification of BioID Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Generation of BioID constructs have described previously [20 (link)]. CD63 was amplified from RFP-CD63 pQCXP CMV/TO vector (for CD63 BirA*) or from pCT-CD63-GFP (for BirA*CD63). For CD63 BirA*, Nhe and EcoRI restriction fragments were ligated into pcDNA3.1-MCS BioID by overnight incubation with T4 DNA ligase. In the case of BirA*CD63, EcoRI and HindIII restriction enzymes were used for the digestion, and the fragments were inserted into pcDNA3.1-myc-BioID as above. The ligations were transformed into DH5α and plated on ampicillin-resistant LB-agar plates, incubated overnight at 37 °C for isolation of transformed colonies. Point mutations were made on CD63 sequences in the cases of both CD63 BirA* and BirA*CD63 on the guide DNA sequences using the GENEART mutagenesis kit (Invitrogen; A13282). The primers used were as follows: BirA_CD63-H to M_1F: 5’GCCTGTGCAGTGGGATTGATCGCCATGGGTGTCGGGGCAC3’ and BirA_CD63-H to M_1R: 5’GTGCCCCGACACCCATGGCGATCAATCCCACTGCACAGGC3’. This mutation facilitated the re-introduction of CD63 constructs under the CD63 CRISPR background successfully. The other constructs used in this study, GFP-LMP1, LMP1 BirA*, and BirA* LMP1, were also described previously [20 (link)].
+ Open protocol
+ Expand
3

Cloning Cyp1a1 and Cyp1b1 Promoters

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA was extracted from mouse kidneys and the corresponding Cyp1a1 and Cyp1b1 promoter fragments were amplified by PCR with primers containing KpnI and XhoI restriction sites. The PCR products were then cloned into pENTR-D/TOPO (Invitrogen/Lifetechnologies) plasmids, which were digested with KpnI and XhoI and then ligated into pGL4.12 (Promega) reporter plasmids.
Mutagenesis was carried out with the GeneArt mutagenesis kit (Invitrogen/Lifetechnologies) according to the manufacturer's instructions. The sequences of reporter constructs were analysed and confirmed.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!