Geneart mutagenesis kit

The M. tuberculosis raaS gene was cloned into the NdeI and NheI sites of the pET15-Tev plasmid to generate a hexahistidine-tagged recombinant protein (4 (link)). Protein expression in Escherichia coli BL21(DE3) was induced by isopropyl β-d-thiogalactopyranoside at a final concentration of 0.2 mm. Recombinant RaaS was purified using a HiTrap 1-ml IMAC HP column (Amersham Biosciences). Site-directed mutants of RaaS were generated using a GeneArt mutagenesis kit (Invitrogen) according to the manufacturer's instructions.

Generation of BioID constructs have described previously [20 (link)]. CD63 was amplified from RFP-CD63 pQCXP CMV/TO vector (for CD63 BirA*) or from pCT-CD63-GFP (for BirA*CD63). For CD63 BirA*, Nhe and EcoRI restriction fragments were ligated into pcDNA3.1-MCS BioID by overnight incubation with T4 DNA ligase. In the case of BirA*CD63, EcoRI and HindIII restriction enzymes were used for the digestion, and the fragments were inserted into pcDNA3.1-myc-BioID as above. The ligations were transformed into DH5α and plated on ampicillin-resistant LB-agar plates, incubated overnight at 37 °C for isolation of transformed colonies. Point mutations were made on CD63 sequences in the cases of both CD63 BirA* and BirA*CD63 on the guide DNA sequences using the GENEART mutagenesis kit (Invitrogen; A13282). The primers used were as follows: BirA_CD63-H to M_1F: 5’GCCTGTGCAGTGGGATTGATCGCCATGGGTGTCGGGGCAC3’ and BirA_CD63-H to M_1R: 5’GTGCCCCGACACCCATGGCGATCAATCCCACTGCACAGGC3’. This mutation facilitated the re-introduction of CD63 constructs under the CD63 CRISPR background successfully. The other constructs used in this study, GFP-LMP1, LMP1 BirA*, and BirA* LMP1, were also described previously [20 (link)].

Genomic DNA was extracted from mouse kidneys and the corresponding Cyp1a1 and Cyp1b1 promoter fragments were amplified by PCR with primers containing KpnI and XhoI restriction sites. The PCR products were then cloned into pENTR-D/TOPO (Invitrogen/Lifetechnologies) plasmids, which were digested with KpnI and XhoI and then ligated into pGL4.12 (Promega) reporter plasmids.
Mutagenesis was carried out with the GeneArt mutagenesis kit (Invitrogen/Lifetechnologies) according to the manufacturer's instructions. The sequences of reporter constructs were analysed and confirmed.