Starscript 2 first strand cdna synthesis kit 2

Total RNA was extracted from 5 × 10⁶ to 5 × 10⁷ cells using the RaPure Total RNA Mini Kit (Magen, #R4011-02), treated with DNAseI to eliminate genomic DNA, and quantitated using the Epoch spectrophotometer. Reverse transcription (RT) followed instructions provided by StarScript II First-strand cDNA Synthesis Kit-II (GenStar, #A214-05). The resulting cDNA was used as a template for the amplification of target gene transcripts by RT-PCR, using Hieff^TM qPCR SYBR^® Green Master Mix (YEASEN, #11201ES08) on the Hema9600 PCR machine. After 35 amplification cycles, reaction products were analyzed and β-actin RNA was used as a loading control. The primer sequences were as follows: survivin forward: CCGACGTTGCCCCCTGC; survivin reverse: TCGATGGCACGGCGCAC; β-actin forward: AAATCGTGCGTGACATTAAGC; β-actin reverse: CCGATCCACACGGAGTACTT (15 (link), 16 (link)).

The sequences of primers used in the RT-PCR assay are in Table S1. Cells were suspended by Trizol (Life Technologies Corporation, California, CA, USA) to exact RNA after harvest. Reverse transcription (RT) was performed using the StarScript II First-strand cDNA Synthesis Kit-II (GenStar, Beijing, China). The RT mixture contained 1μg template RNA, 1 μL oligo (dT)₁₈, 10 μL reaction mix, 1μL StarScript II RT mix, and 8 μL H₂O. The reaction mixture was incubated in a thermocycler programmed at 50 °C for 40 min and then heated at 85 °C for 5 min to denature the StarScript II RT mix.