Control shrna

The plasmid vectors shRNA- NCK1-AS1, pcDNA- NCK1-AS1, and negative control (control shRNA and control pcDNA) were purchased from GenePharma Company (Shanghai, China). The miRNA-137-mimic and negative control miR-NC were synthesized by Invitrogen (Nanjing, China). The plasmid vectors and the mimics were transfected into osteosarcoma cells by Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocols.

All the synthetic short hairpin RNA (shRNA) oligonucleotides, lentivirus expression vector of shRNA against ATM, GLUT1, PKM2, MCT4, MCT1 and the control shRNA were purchased from GenePharma (Shanghai, China). The sequences of shRNA are listed in Supplementary Table 1. The wild type GLUT1 S490 (FHPLGADSQV; WT), mutant GLUT1 S490A (from FHPLGADSQV to FHPLGADAQV to lead a hypo-phosphorylated GLUT1) constructs were generated by GenePharma (Shanghai, China) and inserted into pcDNA-Flag tagged plasmid to get pcDNA-Flag-GLUT1 (WT) and pcDNA-Flag-GLUT1 mutant (S490A). The pcDNA3-Flag-ATM construct was obtained from Addgene.
The engineered CAFs with a stable expression of shATM, shGLUT1, shPKM2, shMCT4 and the breast cancer cells (MDA-MB-231 and BT-549) with a stable expression of shMCT1 were established using the lentivirus infection as described elsewhere. In order to establish the engineered GLUT1 WT- and GLUT1 mutant-CAFs, the endogenous glut1 of CAFs was knocked down by GLUT1 shRNA (named CAF/glut1 KD). The ectopic WT, mutant GLUT1 S490A was then transfected into CAFs to acquire the engineered CAFs stably expressing WT (CAF/ecto-WT) or mutant GLUT1 (CAF/ecto-S490A).

Hypoxia-induced cardiomyocytes were seeded at a concentration of 5×10⁴ cells/mL in six-well plates and incubated overnight. According to the instructions, control-plasmid or SNHG8-plasmid (GenePharma, Shanghai, China), control-shRNA (CATAGCGGTGTAGTAAAGCATAATA) or SNHG8-shRNA (ATTACGATGGATGATGGAAACATA) (GenePharma, Shanghai, China) were transfected into hypoxia-induced cardiomyocytes using Lipofectamine 2000 reagent (Invitrogen, United States). After transfection for 48 h, we collected the cells for further experiments. Cell transfection efficiency was detected through quantitative real-time polymerase chain reaction (qRT-PCR) assay.

The cells were seeded into 24-well plates at a concentration of 3 × 10⁵/mL. After the cells had completely adhered to the wells, the growth medium for the OGD group was replaced with low-glucose medium, and the cells were incubated in a three-gas incubator (5% CO₂, 1% O₂ and 94% N₂) for 24 hours. The cells were divided into six groups (n = 6): the control group, the shRNA-NC group (vector control), the TRPM2-shRNA group, the OGD group, the shRNA-NC + OGD group, and the TRPM2-shRNA + OGD group. When the cells reached 60% confluence, they were transfected with 1 μL/mL TRPM2-shRNA or control shRNA (Shanghai GenePharma Co., Ltd., Shanghai, China) using Lipofectamine^® 2000 (Shanghai Jima Industrial Co., Ltd., Shanghai, China). At 24 hours after transfection, the PC12 cells were subjected to OGD (incubation in glucose-free medium under hypoxic conditions for 8 hours, followed by reoxygenation for 24 hours), as previously described (Singh et al., 2009). The control group did not receive any treatment. The cells in the shRNA-NC group were transfected with the control shRNA. The cells in the shRNA-NC + OGD and TRPM2-shRNA + OGD groups were subjected to OGD.

For knockdown of CXCL1 in MDA-MB-231 and BT-549 cells, lentiviral expression vectors containing CXCL1 short hairpin RNA (shRNA) or control shRNA were obtained from Shanghai GenePharma Co., Ltd. The sequence of CXCL1 shRNA was 5′-GCACATCTGTTTT GTAACT-3′, and the control shRNA sequence was 5′-TTC TCCGAACGTGTCACGT-3′. Cells at a density of 30-50% in 6-well plates were transfected with sh-CXCL1 or sh-Ctrl lentivirus (1×10⁸ TU/ml). After 8-12 h of incubation, the medium was replaced with complete medium containing FBS and puromycin. Further experiments were performed after ≥2 weeks.